Stem-loop sequence dre-mir-152

AccessionMI0002017 (change log)
Previous IDsdre-mir-152-1
DescriptionDanio rerio miR-152 stem-loop
Gene family MIPF0000056; mir-148
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-148/mir-152_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology, miR-148 is a microRNA whose expression has been demonstrated in human (MI0000253), mouse (MI0000550), rat (MI0000616) and zebrafish (MI0002015). miR-148 has also been predicted in chicken (MI0001189). These predicted hairpin precursor sequence are related to those of miR-152, which has been expressed in mouse (MI0000174) and is predicted in human (MI0000462). The hairpin precursors (represented here) are predicted based on base pairing and cross-species conservation; their extents are not known. In this case, the mature sequence is excised from the 3' arm of the hairpin.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   cuguuca  u    c         g  a    ca    uugaa 
5'        cc ggcu aaguucugu au cacu  gacu     u
          || |||| ||||||||| || ||||  ||||     c
3'        gg ccgg uucaagaca ua guga  cuga     a
   -------  c    u         g  c    --    uggug 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr3: 24095957-24096036 [+]
sense
OTTDART00000024534 ; copz2-001; intron 1
OTTDART00000024535 ; copz2-002; intron 1
OTTDART00000024536 ; copz2-003; intron 1
ENSDART00000138270 ; copz2-001; intron 1
ENSDART00000131509 ; copz2-002; intron 1
ENSDART00000139181 ; copz2-003; intron 1
ENSDART00000002177 ; copz2-201; intron 2
KZ115068.1: 105256-105335 [+]
sense
OTTDART00000024534 ; copz2-001; intron 1
OTTDART00000024535 ; copz2-002; intron 1
OTTDART00000024536 ; copz2-003; intron 1
ENSDART00000138270 ; copz2-001; intron 1
ENSDART00000131509 ; copz2-002; intron 1
ENSDART00000139181 ; copz2-003; intron 1
ENSDART00000002177 ; copz2-201; intron 2
Database links

Mature sequence dre-miR-152

Accession MIMAT0001847
Sequence

54 - 

ucagugcaugacagaacuuugg

 - 75

Get sequence
Evidence by similarity; MI0000174
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).