Stem-loop sequence dre-mir-153b

AccessionMI0002019 (change log)
Previous IDsdre-mir-153b-1
DescriptionDanio rerio miR-153b stem-loop
Gene family MIPF0000050; mir-153
Literature search

4 open access papers mention dre-mir-153b
(138 sentences)

Stem-loop
   ga           ---  g     ag  -auu -    g         -           gu -       a uagu 
5'   gcgauggagcg   cg uagcg  gu    g caca cugucugug ucauuuuugug  u ugcagcu g    c
     |||||||||||   || |||||  ||    | |||| ||||||||| |||||||||||  | ||||||| |     
3'   cgcuaccucgc   gu gucgc  cg    c gugu gacagacac aguaaaaacac  a acguuga c    u
   -c           aaa  a     aa  acgu a    a         g           ug u       c uugg 
Get sequence
Deep sequencing
11132 reads, 264 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr6: 13980945-13981092 [+]
sense
OTTDART00000054351 ; ptprnb-001; intron 18
ENSDART00000109144 ; ptprnb-201; intron 7
ENSDART00000155480 ; ptprnb-001; intron 18
Database links

Mature sequence dre-miR-153b-5p

Accession MIMAT0031977
Sequence

43 - 

gucauuuuugugguuugcagcu

 - 64

Get sequence
Deep sequencing4651 reads, 5 experiments
Evidence not experimental
Database links

Mature sequence dre-miR-153b-3p

Accession MIMAT0001848
Previous IDsdre-miR-153b
Sequence

81 - 

uugcauagucacaaaaaugagc

 - 102

Get sequence
Deep sequencing6254 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).