Stem-loop sequence dre-mir-153c

AccessionMI0002022 (change log)
DescriptionDanio rerio miR-153c stem-loop
Gene family MIPF0000050; mir-153
Literature search

4 open access papers mention dre-mir-153c
(137 sentences)

Stem-loop
          -   -a       -----    gac   -g       c      -              -       a uagu 
5' gauggag auc  guagguc     ccug   gua  cacaccu ccagug ucauuuuugugauu ugcagcu g    c
   ||||||| |||  |||||||     ||||   |||  ||||||| |||||| |||||||||||||| ||||||| |     
3' cuaccuc uag  cauucgg     ggac   cgu  gugugga gguuac aguaaaaacacuga acguuga c    u
          c   gc       aguga    -ga   ga       u      u              u       c uggg 
Get sequence
Deep sequencing
11469 reads, 282 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr9: 7612376-7612526 [+]
sense
OTTDART00000045866 ; ptprna-002; intron 3
OTTDART00000045865 ; ptprna-001; intron 19
ENSDART00000143847 ; ptprna-002; intron 3
ENSDART00000081543 ; ptprna-001; intron 19
Database links

Mature sequence dre-miR-153c-5p

Accession MIMAT0031979
Sequence

43 - 

gucauuuuugugauuugcagcu

 - 64

Get sequence
Deep sequencing4501 reads, 5 experiments
Evidence not experimental
Database links

Mature sequence dre-miR-153c-3p

Accession MIMAT0001850
Previous IDsdre-miR-153c
Sequence

81 - 

uugcauagucacaaaaaugauc

 - 102

Get sequence
Deep sequencing6813 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).