Stem-loop sequence dre-mir-155

AccessionMI0002023
DescriptionDanio rerio miR-155 stem-loop
Gene family MIPF0000157; mir-155
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-155. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

MiR-155 is a microRNA that in humans is encoded by the MIR155 host gene or MIR155HG. MiR-155 plays an important role in various physiological and pathological processes. Exogenous molecular control in vivo of miR-155 expression may inhibit malignant growth, viral infections, and attenuate the progression of cardiovascular diseases.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
            u           c  g     g     gu 
5' uggugcagg uuaaugcuaau gu auagg guuua  g
   ||||||||| ||||||||||| || ||||| |||||  c
3' aucgcguuc aauuacgauug cg uaucc caagu  u
            u           u  -     a     ag 
Get sequence
Deep sequencing
217 reads, 25.6 reads per million, 4 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
1: 451141-451218 [+]
sense
OTTDART00000040955 ; mrpl39-002; intron 10
ENSDART00000060944 ; mrpl39-002; intron 10
Database links

Mature sequence dre-miR-155

Accession MIMAT0001851
Sequence

11 - 

uuaaugcuaaucgugauagggg

 - 32

Get sequence
Deep sequencing183 reads, 4 experiments
Evidence experimental; cloned [1]

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).