Stem-loop sequence dre-mir-184-1

AccessionMI0002026 (change log)
Previous IDsdre-mir-184
DescriptionDanio rerio miR-184 stem-loop
Gene family MIPF0000059; mir-184
Literature search

5 open access papers mention dre-mir-184-1
(106 sentences)

Stem-loop
       aa     c         c      a c     uauccau 
5' gucg  cacgu uccuuauca uuuucc g ccagc       u
   ||||  ||||| ||||||||| |||||| | |||||        
3' uagc  gugua gggaauagu aagagg c gguug       u
       cc     c         c      - a     cuuauga 
Get sequence
Deep sequencing
364328 reads, 2.21e+04 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr18: 26203303-26203389 [-]
intergenic
Database links

Mature sequence dre-miR-184

Accession MIMAT0001853
Sequence

55 - 

uggacggagaacugauaagggc

 - 76

Get sequence
Deep sequencing728181 reads, 11 experiments
Evidence by similarity; MI0002026
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).