Stem-loop sequence dre-mir-184-1

AccessionMI0002026
Previous IDsdre-mir-184
DescriptionDanio rerio miR-184 stem-loop
Gene family MIPF0000059; mir-184
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-184. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology, miR-184 microRNA is a short non-coding RNA molecule. MicroRNAs (miRNAs) function as posttranscriptional regulators of expression levels of other genes by several mechanisms. Several targets for miR-184 have been described, including that of mediators of neurological development, apoptosis and it has been suggested that miR-184 plays an essential role in development. MicroRNAs can bind to the three prime untranslated region (3’UTR) of the target messenger RNA (mRNA). Binding of the miRNA can hinder translation of mRNA by promoting degradation or inducing deadenylation.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
       aa     c         c      a c     uauccau 
5' gucg  cacgu uccuuauca uuuucc g ccagc       u
   ||||  ||||| ||||||||| |||||| | |||||        
3' uagc  gugua gggaauagu aagagg c gguug       u
       cc     c         c      - a     cuuauga 
Get sequence
Deep sequencing
2010 reads, 348 reads per million, 4 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
18: 25989792-25989878 [-]
intergenic
Database links

Mature sequence dre-miR-184

Accession MIMAT0001853
Sequence

55 - 

uggacggagaacugauaagggc

 - 76

Get sequence
Deep sequencing5311 reads, 4 experiments
Evidence by similarity; MI0002026

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).