Stem-loop sequence dre-mir-190a

AccessionMI0002027 (change log)
Previous IDsdre-mir-190
DescriptionDanio rerio miR-190 stem-loop
Gene family MIPF0000076; mir-190
   ucuggaggugagguagaccuggaagccuuucu     c u    -uu                ua     uuau 
5'                                 gcagg c cugu   gauauguuugauauau  gguug    u
                                   ||||| | ||||   ||||||||||||||||  |||||     
3'                                 cgucc g gaca   uuauacaaacuauaua  ucaac    c
   ---------------------gaccucugucu     u u    ucc                --     cugu 
Get sequence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr25: 33139075-33139200 [+]
ENSDART00000023584 ; TLN2 (2 of 2)-201; intron 38
Database links

Mature sequence dre-miR-190a

Accession MIMAT0001854
Previous IDsdre-miR-190

46 - 


 - 67

Get sequence
Evidence by similarity; MI0000232
Database links
Predicted targets


PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).