Stem-loop sequence dre-mir-190a

AccessionMI0002027
Previous IDsdre-mir-190
DescriptionDanio rerio miR-190 stem-loop
Gene family MIPF0000076; mir-190
Stem-loop
   ucuggaggugagguagaccuggaagccuuucu     c u    -uu                ua     uuau 
5'                                 gcagg c cugu   gauauguuugauauau  gguug    u
                                   ||||| | ||||   ||||||||||||||||  |||||     
3'                                 cgucc g gaca   uuauacaaacuauaua  ucaac    c
   ---------------------gaccucugucu     u u    ucc                --     cugu 
Get sequence
Deep sequencing
147 reads, 24.6 reads per million, 4 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
25: 34002214-34002339 [-]
sense
ENSDART00000023584 ; TLN2 (2 of 2)-201; intron 38
Database links

Mature sequence dre-miR-190a

Accession MIMAT0001854
Previous IDsdre-miR-190
Sequence

46 - 

ugauauguuugauauauuaggu

 - 67

Get sequence
Deep sequencing130 reads, 4 experiments
Evidence by similarity; MI0000232

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).