Stem-loop sequence dre-mir-462

AccessionMI0002028 (change log)
DescriptionDanio rerio miR-462 stem-loop
Gene family MIPF0001755; mir-462
Literature search

4 open access papers mention dre-mir-462
(16 sentences)

   --------------------gucuggauggua      c     au       u ug   g 
5'                                 acggaa ccaua  gcagcug u  guu a
                                   |||||| |||||  ||||||| |  |||  
3'                                 ugccuu ggugu  ugucgac a  uag u
   uagaguuacucgaggacguucuuuccuccccg      a     -c       - gu   u 
Get sequence
Deep sequencing
567657 reads, 3.81e+04 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr8: 26082308-26082409 [+]
Clustered miRNAs
< 10kb from dre-mir-462
dre-mir-462chr8: 26082308-26082409 [+]
dre-mir-731chr8: 26082534-26082623 [+]
Database links

Mature sequence dre-miR-462

Accession MIMAT0001855

11 - 


 - 32

Get sequence
Deep sequencing566696 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets


PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).