Stem-loop sequence dre-mir-462

AccessionMI0002028
DescriptionDanio rerio miR-462 stem-loop
Gene family MIPF0001755; mir-462
Stem-loop
   --------------------gucuggauggua      c     au       u ug   g 
5'                                 acggaa ccaua  gcagcug u  guu a
                                   |||||| |||||  ||||||| |  |||  
3'                                 ugccuu ggugu  ugucgac a  uag u
   uagaguuacucgaggacguucuuuccuccccg      a     -c       - gu   u 
Get sequence
Deep sequencing
330 reads, 216 reads per million, 4 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
8: 26935251-26935352 [+]
intergenic
Clustered miRNAs
< 10kb from dre-mir-462
dre-mir-4628: 26935251-26935352 [+]
dre-mir-7318: 26935477-26935566 [+]
Database links

Mature sequence dre-miR-462

Accession MIMAT0001855
Sequence

11 - 

uaacggaacccauaaugcagcu

 - 32

Get sequence
Deep sequencing295 reads, 4 experiments
Evidence experimental; cloned [1]

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).