Stem-loop sequence dre-mir-193a-1

AccessionMI0002029
DescriptionDanio rerio miR-193a-1 stem-loop
Gene family MIPF0000082; mir-193
Stem-loop
   gacauua   u      gg     u     cg   a  g    u   ua 
5'        aug guuaga  uuggg cuuug  ggc ag ugag agu  a
          ||| ||||||  ||||| |||||  ||| || |||| |||  a
3'        uac cggucu  gaccc gaaac  ccg uc acuc uca  u
   -cuauug   u      uu     u     au   g  a    -   uu 
Get sequence
Deep sequencing
8 reads, 4.72 reads per million, 3 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
3: 44210575-44210673 [+]
intergenic
Clustered miRNAs
< 10kb from dre-mir-193a-1
dre-mir-193a-13: 44210575-44210673 [+]
dre-mir-365-23: 44211652-44211749 [+]
Database links

Mature sequence dre-miR-193a-5p

Accession MIMAT0031981
Sequence

21 - 

ugggucuuugcgggcaagguga

 - 42

Get sequence
Deep sequencing47 reads, 4 experiments
Evidence not experimental

Mature sequence dre-miR-193a-3p

Accession MIMAT0001856
Previous IDsdre-miR-193a
Sequence

61 - 

aacuggccuacaaagucccagu

 - 82

Get sequence
Deep sequencing16 reads, 1 experiments
Evidence experimental; cloned [1]

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).