Stem-loop sequence dre-mir-193a-2

AccessionMI0002030 (change log)
DescriptionDanio rerio miR-193a-2 stem-loop
Gene family MIPF0000082; mir-193
Literature search

3 open access papers mention dre-mir-193a-2
(7 sentences)

Stem-loop
       -------   u   ag        u     cg   a  g     uuu 
5' gaga       gug guc  aggcuggg cuuug  ggc ag ugagu   c
   ||||       ||| |||  |||||||| |||||  ||| || |||||   c
3' cucu       uac cgg  uuugaccc gaaac  ccg uc acuua   u
       accagug   c   cu        u     au   g  a     cuu 
Get sequence
Deep sequencing
180 reads, 9.09 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr6: 18517970-18518067 [-]
intergenic
Clustered miRNAs
< 10kb from dre-mir-193a-2
dre-mir-193a-2chr6: 18517970-18518067 [-]
dre-mir-365-3chr6: 18516311-18516409 [-]
Database links

Mature sequence dre-miR-193a-5p

Accession MIMAT0031981
Sequence

18 - 

ugggucuuugcgggcaagguga

 - 39

Get sequence
Deep sequencing222 reads, 10 experiments
Evidence not experimental

Mature sequence dre-miR-193a-3p

Accession MIMAT0001856
Previous IDsdre-miR-193a
Sequence

55 - 

aacuggccuacaaagucccagu

 - 76

Get sequence
Deep sequencing134 reads, 7 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).