Stem-loop sequence dre-mir-193a-2

AccessionMI0002030
DescriptionDanio rerio miR-193a-2 stem-loop
Gene family MIPF0000082; mir-193
Stem-loop
       -------   u   ag        u     cg   a  g     uuu 
5' gaga       gug guc  aggcuggg cuuug  ggc ag ugagu   c
   ||||       ||| |||  |||||||| |||||  ||| || |||||   c
3' cucu       uac cgg  uuugaccc gaaac  ccg uc acuua   u
       accagug   c   cu        u     au   g  a     cuu 
Get sequence
Deep sequencing
63 reads, 18.2 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
6: 19392325-19392422 [+]
intergenic
Clustered miRNAs
< 10kb from dre-mir-193a-2
dre-mir-193a-26: 19392325-19392422 [+]
dre-mir-365-36: 19393983-19394081 [+]
Database links

Mature sequence dre-miR-193a-5p

Accession MIMAT0031981
Sequence

18 - 

ugggucuuugcgggcaagguga

 - 39

Get sequence
Deep sequencing47 reads, 4 experiments
Evidence not experimental

Mature sequence dre-miR-193a-3p

Accession MIMAT0001856
Previous IDsdre-miR-193a
Sequence

55 - 

aacuggccuacaaagucccagu

 - 76

Get sequence
Deep sequencing16 reads, 1 experiments
Evidence experimental; cloned [1]

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).