Stem-loop sequence dre-mir-193b

AccessionMI0002032
DescriptionDanio rerio miR-193b stem-loop
Gene family MIPF0000082; mir-193
Stem-loop
       - uu   uga          g    g  a  ag  uug 
5' guga u  cag   cgggacuuug gggc ag ug  ua   a
   |||| |  |||   |||||||||| |||| || ||  ||    
3' cacu a  guc   gcccugaaac cccg uc ac  au   u
       c gg   uuc          g    g  a  cu  cuc 
Get sequence
Deep sequencing
827 reads, 226 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
3: 42895139-42895223 [-]
sense
OTTDART00000053888 ; si:ch73-156l6.2-001; intron 1
ENSDART00000155441 ; si:ch73-156l6.2-001; intron 1
Clustered miRNAs
< 10kb from dre-mir-193b
dre-mir-193b3: 42895139-42895223 [-]
dre-mir-365-13: 42893007-42893095 [-]
Database links

Mature sequence dre-miR-193b-5p

Accession MIMAT0031982
Sequence

14 - 

cgggacuuugggggcgagaug

 - 34

Get sequence
Deep sequencing397 reads, 4 experiments
Evidence not experimental

Mature sequence dre-miR-193b-3p

Accession MIMAT0001857
Previous IDsdre-miR-193b
Sequence

52 - 

aacuggcccgcaaagucccgcu

 - 73

Get sequence
Deep sequencing323 reads, 3 experiments
Evidence experimental; cloned [1]

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).