Stem-loop sequence dre-mir-193b

AccessionMI0002032 (change log)
DescriptionDanio rerio miR-193b stem-loop
Gene family MIPF0000082; mir-193
Stem-loop
       - uu   uga          g    g  a  ag  uug 
5' guga u  cag   cgggacuuug gggc ag ug  ua   a
   |||| |  |||   |||||||||| |||| || ||  ||    
3' cacu a  guc   gcccugaaac cccg uc ac  au   u
       c gg   uuc          g    g  a  cu  cuc 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr3: 43714699-43714783 [+]
sense
OTTDART00000053888 ; si:ch73-156l6.2-001; intron 1
ENSDART00000155441 ; si:ch73-156l6.2-001; intron 1
Clustered miRNAs
< 10kb from dre-mir-193b
dre-mir-193bchr3: 43714699-43714783 [+]
dre-mir-365-1chr3: 43716827-43716915 [+]
Database links

Mature sequence dre-miR-193b-5p

Accession MIMAT0031982
Sequence

14 - 

cgggacuuugggggcgagaug

 - 34

Get sequence
Evidence not experimental
Database links

Mature sequence dre-miR-193b-3p

Accession MIMAT0001857
Previous IDsdre-miR-193b
Sequence

52 - 

aacuggcccgcaaagucccgcu

 - 73

Get sequence
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).