Stem-loop sequence dre-mir-194a

AccessionMI0002033
DescriptionDanio rerio miR-194a stem-loop
Gene family MIPF0000055; mir-194
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-194_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology, miR-194 microRNA precursor is a small non-coding RNA gene that regulated gene expression. Its expression has been verified in mouse (MI0000236, MI0000733) and in human (MI0000488, MI0000732). mir-194 appears to be a vertebrate-specific miRNA and has now been predicted or experimentally confirmed in a range of vertebrate species (MIPF0000055). The mature microRNA is processed from the longer hairpin precursor by the Dicer enzyme. In this case, the mature sequence is excised from the 5' arm of the hairpin.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   u    -   a    u          a      g       uu 
5'  ggug cug cugc uguaacagca cuccau uggaagg  u
    |||| ||| |||| |||||||||| |||||| |||||||   
3'  ccac gau gacg gcguugucgu gaggug accuucu  g
   a    u   a    u          c      -       gu 
Get sequence
Deep sequencing
3204 reads, 481 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
10: 27698667-27698750 [+]
intergenic
Clustered miRNAs
< 10kb from dre-mir-194a
dre-mir-194a10: 27698667-27698750 [+]
dre-mir-19210: 27698847-27698931 [+]
Database links

Mature sequence dre-miR-194a

Accession MIMAT0001858
Sequence

15 - 

uguaacagcaacuccaugugg

 - 35

Get sequence
Deep sequencing2678 reads, 4 experiments
Evidence experimental; cloned [1]

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).