Stem-loop sequence dre-mir-196a-2

AccessionMI0002035
DescriptionDanio rerio miR-196a-2 stem-loop
Gene family MIPF0000031; mir-196
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-196_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-196 is a non-coding RNA called a microRNA that has been shown to be expressed in human (MI0000238, MI0000279) and mouse (MI0000552, MI0000553). miR-196 appears to be a vertebrate specific microRNA and has now been predicted or experimentally confirmed in a wide range of vertebrate species (MIPF0000031). In many species the miRNA appears to be expressed from intergenic regions in HOX gene clusters. The hairpin precursors are predicted based on base pairing and cross-species conservation—their extents are not known. In this case the mature sequence is excised from the 5' arm of the hairpin. It has been suggested that a rare SNP (rs11614913) that overlaps hsa-mir-196a2 has been found to be associated with non-small cell lung carcinoma.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   ucga ug   u  gu             u   a  ac 
5'     g  guu ag  aguuucauguugu ggg uu  a
       |  ||| ||  ||||||||||||| ||| ||   
3'     c  uaa uc  ucaaagugcaacg cuc aa  u
   accc gu   u  ug             u   a  cu 
Get sequence
Deep sequencing
593 reads, 74.4 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
19: 19213364-19213439 [+]
sense
OTTDART00000018144 ; hoxa9a-002; intron 1
ENSDART00000147736 ; hoxa9a-002; intron 1
antisense
OTTDART00000059902 ; si:dkey-25e11.13-003; intron 1
OTTDART00000018121 ; evx1-001; intron 2
OTTDART00000043481 ; si:dkey-25e11.13-001; intron 2
ENSDART00000157108 ; si:dkey-25e11.13-003; intron 1
ENSDART00000147608 ; evx1-001; intron 2
ENSDART00000132654 ; si:dkey-25e11.13-001; intron 2
Database links

Mature sequence dre-miR-196a-5p

Accession MIMAT0001276
Previous IDsdre-miR-196a
Sequence

11 - 

uagguaguuucauguuguuggg

 - 32

Get sequence
Deep sequencing3632 reads, 4 experiments
Evidence experimental; cloned [1]

Mature sequence dre-miR-196a-3p

Accession MIMAT0031983
Sequence

47 - 

cugcaacgugaaacugucuuaa

 - 68

Get sequence
Deep sequencing177 reads, 4 experiments
Evidence not experimental

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).