Stem-loop sequence dre-mir-196b

AccessionMI0002036
DescriptionDanio rerio miR-196b stem-loop
Gene family MIPF0000031; mir-196
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-196_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-196 is a non-coding RNA called a microRNA that has been shown to be expressed in human (MI0000238, MI0000279) and mouse (MI0000552, MI0000553). miR-196 appears to be a vertebrate specific microRNA and has now been predicted or experimentally confirmed in a wide range of vertebrate species (MIPF0000031). In many species the miRNA appears to be expressed from intergenic regions in HOX gene clusters. The hairpin precursors are predicted based on base pairing and cross-species conservation—their extents are not known. In this case the mature sequence is excised from the 5' arm of the hairpin. It has been suggested that a rare SNP (rs11614913) that overlaps hsa-mir-196a2 has been found to be associated with non-small cell lung carcinoma.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   gucu ug               a   g   ggc    cgu 
5'     g  auuuagguaguuuca guu uug   ugga   u
       |  ||||||||||||||| ||| |||   ||||    
3'     c  uaaguccgucaaagu caa gac   acuu   u
   accu gu               c   g   ---    uaa 
Get sequence
Deep sequencing
2239 reads, 243 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
3: 23964618-23964696 [+]
intergenic
Database links

Mature sequence dre-miR-196b

Accession MIMAT0001860
Sequence

11 - 

uagguaguuucaaguuguuggg

 - 32

Get sequence
Deep sequencing1646 reads, 4 experiments
Evidence experimental; cloned [1]
Validated targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).