Stem-loop sequence dre-mir-200b

AccessionMI0002038
DescriptionDanio rerio miR-200b stem-loop
Gene family MIPF0000019; mir-8
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-8/mir-141/mir-200_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-8 microRNA precursor (homologous to miR-141, miR-200, miR-236), is a short non-coding RNA gene involved in gene regulation. miR-8 in Drosophila melanogaster is expressed from the 3' arm of related precursor hairpins (represented here), along with miR-200, miR-236, miR-429 and human and mouse homolog miR-141. Members of this precursor family have now been predicted or experimentally confirmed in a wide range of species. The bounds of the precursors are predicted based on conservation and base pairing and are not generally known. The miR-200 family is highly conserved in bilaterian animals, with miR-8 as the sole homolog in Drosophila. This species has accordingly been used heavily in work looking to uncover the biological function of the miR-200 family. miR-8 has been observed at all developmental stages of the embryo, with a complete absence from cultured S2 cells of D. melanogaster. Its expression has been seen to be strongly upregulated in larvae and this expression then sustained through to adulthood.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
         c   uc    -    g      c      uuuca 
5' gguagu guc  cauc uuac aggcag auugga     u
   |||||| |||  |||| |||| |||||| ||||||     u
3' ccgucg uag  guag aaug uccguc uaaucu     a
         u   ua    u    g      a      uuuuc 
Get sequence
Deep sequencing
23710 reads, 6.91e+03 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
23: 24358912-24358993 [+]
intergenic
Clustered miRNAs
< 10kb from dre-mir-200b
dre-mir-200b23: 24358912-24358993 [+]
dre-mir-200a23: 24359043-24359128 [+]
dre-mir-429a23: 24360698-24360779 [+]
dre-mir-714923: 24360966-24361038 [+]
Database links

Mature sequence dre-miR-200b-5p

Accession MIMAT0031985
Sequence

13 - 

caucuuacgaggcagcauugga

 - 34

Get sequence
Deep sequencing308 reads, 4 experiments
Evidence not experimental

Mature sequence dre-miR-200b-3p

Accession MIMAT0001862
Previous IDsdre-miR-200b
Sequence

50 - 

uaauacugccugguaaugauga

 - 71

Get sequence
Deep sequencing21428 reads, 4 experiments
Evidence experimental; cloned [1]
Validated targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).