Stem-loop sequence dre-mir-202

AccessionMI0002040 (change log)
DescriptionDanio rerio miR-202 stem-loop
Gene family MIPF0000121; mir-202
Stem-loop
          u           -a   a         cau 
5' cuguucc uuuuccuaugc  uau ccucuuuga   g
   ||||||| |||||||||||  ||| |||||||||   c
3' ggcgggg aaaaggguacg  aua ggagaaauu   u
          u           gg   c         ucg 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr13: 50602639-50602714 [+]
intergenic
Database links

Mature sequence dre-miR-202-5p

Accession MIMAT0003406
Previous IDsdre-miR-202*
Sequence

11 - 

uuccuaugcauauaccucuuug

 - 32

Get sequence
Evidence experimental; cloned [1]
Database links

Mature sequence dre-miR-202-3p

Accession MIMAT0001864
Previous IDsdre-miR-202
Sequence

47 - 

agaggcauagggcaugggaaaa

 - 68

Get sequence
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).