Stem-loop sequence dre-mir-202

AccessionMI0002040
DescriptionDanio rerio miR-202 stem-loop
Gene family MIPF0000121; mir-202
Stem-loop
          u           -a   a         cau 
5' cuguucc uuuuccuaugc  uau ccucuuuga   g
   ||||||| |||||||||||  ||| |||||||||   c
3' ggcgggg aaaaggguacg  aua ggagaaauu   u
          u           gg   c         ucg 
Get sequence
Deep sequencing
53 reads, 16.3 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
13: 54068641-54068716 [-]
intergenic
Database links

Mature sequence dre-miR-202-5p

Accession MIMAT0003406
Previous IDsdre-miR-202*
Sequence

11 - 

uuccuaugcauauaccucuuug

 - 32

Get sequence
Deep sequencing28 reads, 4 experiments
Evidence experimental; cloned [1]

Mature sequence dre-miR-202-3p

Accession MIMAT0001864
Previous IDsdre-miR-202
Sequence

47 - 

agaggcauagggcaugggaaaa

 - 68

Get sequence
Deep sequencing17 reads, 4 experiments
Evidence experimental; cloned [1]

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).