Stem-loop sequence dre-mir-203b

AccessionMI0002041
DescriptionDanio rerio miR-203b stem-loop
Gene family MIPF0000108; mir-203
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled MiR-203. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology miR-203 is a short non-coding RNA molecule. MicroRNAs function to regulate the expression levels of other genes by several mechanisms, such as translational repression and Argonaute-catalyzed messenger RNA cleavage. miR-203 has been identified as a skin-specific microRNA, and it forms an expression gradient that defines the boundary between proliferative epidermal basal progenitors and terminally differentiating suprabasal cells. It has also been found upregulated in psoriasis and differentially expressed in some types of cancer.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
       - -    gc           c    g    a     cuu 
5' uccu c uuug  cgagugguucu aaca uuca caguu   u
   |||| | ||||  ||||||||||| |||| |||| |||||    
3' agga g agac  guucaccagga uugu aagu guuag   u
       a c    ua           c    a    -     uag 
Get sequence
Deep sequencing
130218 reads, 2.4e+04 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
20: 27435485-27435569 [+]
intergenic
Database links

Mature sequence dre-miR-203b-5p

Accession MIMAT0003407
Previous IDsdre-miR-203b*
Sequence

14 - 

agugguucucaacaguucaaca

 - 35

Get sequence
Deep sequencing124 reads, 4 experiments
Evidence experimental; cloned [1]

Mature sequence dre-miR-203b-3p

Accession MIMAT0001865
Previous IDsdre-miR-203b
Sequence

51 - 

gugaaauguucaggaccacuug

 - 72

Get sequence
Deep sequencing100392 reads, 4 experiments
Evidence experimental; cloned [1]

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).