Stem-loop sequence dre-mir-204-2

AccessionMI0002042
DescriptionDanio rerio miR-204-2 stem-loop
Gene family MIPF0000042; mir-204
Stem-loop
         -  c     ac   uuug    cuc   gg           ca     u    g  guu 
5' guguug cu uagug  cag    ugac   cug  uuucccuuugu  uccua gccu ca   c
   |||||| || |||||  |||    ||||   |||  |||||||||||  ||||| |||| ||    
3' cauaac ga aucau  guc    gcug   gac  ggagggaaacg  agggu cgga gu   c
         u  c     --   --ca    -ua   uu           ac     -    -  agu 
Get sequence
Deep sequencing
688 reads, 73.5 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
7: 30673504-30673627 [-]
sense
OTTDART00000037128 ; trpm1a-003; intron 5
OTTDART00000037126 ; trpm1a-001; intron 6
ENSDART00000052584 ; trpm1a-201; intron 4
ENSDART00000147919 ; trpm1a-003; intron 5
ENSDART00000140938 ; trpm1a-001; intron 6
ENSDART00000086664 ; trpm1a-202; intron 6
Database links

Mature sequence dre-miR-204-5p

Accession MIMAT0001279
Previous IDsdre-miR-204
Sequence

37 - 

uucccuuugucauccuaugccu

 - 58

Get sequence
Deep sequencing1408 reads, 4 experiments
Evidence experimental; cloned [1]

Mature sequence dre-miR-204-2-3p

Accession MIMAT0031987
Sequence

74 - 

gcugggacagcaaagggaggu

 - 94

Get sequence
Deep sequencing65 reads, 4 experiments
Evidence not experimental

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).