Stem-loop sequence dre-mir-206-1

AccessionMI0002045
DescriptionDanio rerio miR-206-1 stem-loop
Gene family MIPF0000038; mir-1
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-1_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-1 microRNA precursor is a small micro RNA that regulates its target protein's expression in the cell. microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide products. In this case the mature sequence comes from the 3' arm of the precursor. The mature products are thought to have regulatory roles through complementarity to mRNA. In humans there are two distinct microRNAs that share an identical mature sequence, these are called miR-1-1 and miR-1-2. These micro RNAs have pivotal roles in development and physiology of muscle tissues including the heart. MiR-1 is known to be involved in important role in heart diseases such as hypertrophy, myocardial infarction, and arrhythmias. Studies have shown that MiR-1 is an important regulator of heart adaption after ischemia or ischaemic stress and it is upregulated in the remote myocardium of patients with myocardial infarction. Also MiR-1 is downregulated in myocardial infarcted tissue compared to healthy heart tissue. Plasma levels of MiR-1 can be used as a sensitive biomarker for myocardial infarction.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   ---    guug       u  ag                gc     uuaau 
5'    gaau    ccucuug ga  acaugcuuccuuauau  ccaua     g
      ||||    ||||||| ||  ||||||||||||||||  |||||     c
3'    uuua    gggggac uu  ugugugaaggaaugua  gguau     u
   cug    --aa       u  gg                -a     ugaac 
Get sequence
Deep sequencing
196561 reads, 1.69e+04 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
20: 19616808-19616906 [-]
sense
OTTDART00000058152 ; si:ch211-101l18.8-001; intron 1
ENSDART00000152763 ; si:ch211-101l18.8-001; intron 1
Clustered miRNAs
< 10kb from dre-mir-206-1
dre-mir-206-120: 19616808-19616906 [-]
dre-mir-133b20: 19615539-19615622 [-]
Database links

Mature sequence dre-miR-206-5p

Accession MIMAT0031988
Sequence

21 - 

acaugcuuccuuauaugcccaua

 - 43

Get sequence
Deep sequencing75 reads, 1 experiments
Evidence not experimental

Mature sequence dre-miR-206-3p

Accession MIMAT0001866
Previous IDsdre-miR-206
Sequence

59 - 

uggaauguaaggaagugugugg

 - 80

Get sequence
Deep sequencing186845 reads, 4 experiments
Evidence experimental; cloned [1]

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).