Stem-loop sequence dre-mir-216b

AccessionMI0002048 (change log)
Previous IDsdre-mir-216b-1
DescriptionDanio rerio miR-216b stem-loop
Gene family MIPF0000054; mir-216
Literature search

1 open access papers mention dre-mir-216b
(3 sentences)

Stem-loop
     u     gg        g    -   c     ugu   u 
5' ac gacug  uaaucucu cagg caa uguga   gau a
   || |||||  |||||||| |||| ||| |||||   |||  
3' ug cugac  guuggaga gucc guu acacu   cug c
     u     ga        a    a   -     ---   a 
Get sequence
Deep sequencing
230 reads, 0 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr22: 28780257-28780333 [-]
intergenic
Clustered miRNAs
< 10kb from dre-mir-216b
dre-mir-216bchr22: 28780257-28780333 [-]
dre-mir-216achr22: 28779949-28780037 [-]
dre-mir-217chr22: 28779715-28779812 [-]
Database links

Mature sequence dre-miR-216b

Accession MIMAT0001867
Sequence

11 - 

uaaucucugcaggcaacuguga

 - 32

Get sequence
Deep sequencing206 reads, 11 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).