Stem-loop sequence dre-mir-216b

AccessionMI0002048
Previous IDsdre-mir-216b-1
DescriptionDanio rerio miR-216b stem-loop
Gene family MIPF0000054; mir-216
Stem-loop
     u     gg        g    -   c     ugu   u 
5' ac gacug  uaaucucu cagg caa uguga   gau a
   || |||||  |||||||| |||| ||| |||||   |||  
3' ug cugac  guuggaga gucc guu acacu   cug c
     u     ga        a    a   -     ---   a 
Get sequence
Deep sequencing
24 reads, 3.93 reads per million, 2 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
22: 31337021-31337097 [-]
intergenic
Clustered miRNAs
< 10kb from dre-mir-216b
dre-mir-216b22: 31337021-31337097 [-]
dre-mir-216a22: 31336713-31336801 [-]
dre-mir-21722: 31336479-31336576 [-]
Database links

Mature sequence dre-miR-216b

Accession MIMAT0001867
Sequence

11 - 

uaaucucugcaggcaacuguga

 - 32

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).