Stem-loop sequence dre-mir-218b

AccessionMI0002053
DescriptionDanio rerio miR-218b stem-loop
Gene family MIPF0000026; mir-218
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-218_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-218 microRNA precursor is a small non-coding RNA that regulates gene expression by antisense binding. miR-218 appears to be a vertebrate specific microRNA and has now been predicted and experimentally confirmed in a wide range of vertebrate species. The extents of the hairpin precursors are not known. In this case the mature sequence in excised from the 5'arm of the hairpin. miR-218, along with miR-585, has been found to be silenced by DNA methylation in oral squamous cell carcinoma. It is also downregulated in Nasopharyngeal carcinoma, with artificially-induced expression serving to slow tumour growth. miR-218 has also been found to have tumour suppressing qualities in bladder cancer cells.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
       a a   uu       auc        --   uuc 
5' cagg c cca  gugcuug   uaaccaug  cag   c
   |||| | |||  |||||||   ||||||||  |||    
3' guuc g ggu  cacgaac   guugguac  guc   c
       a a   uu       cgu        cu   uuu 
Get sequence
Deep sequencing
50 reads, 6.79 reads per million, 4 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
10: 17725485-17725560 [+]
intergenic
Database links

Mature sequence dre-miR-218b

Accession MIMAT0001869
Sequence

11 - 

uugugcuugaucuaaccaugca

 - 32

Get sequence
Deep sequencing33 reads, 4 experiments
Evidence experimental; cloned [1]

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).