Stem-loop sequence dre-mir-301b

Accession

MI0002061 (change log)

Description

Danio rerio miR-301b stem-loop

Gene family

MIPF0000034; mir-130

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-130_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

In molecular biology, miR-130 microRNA precursor is a small non-coding RNA that regulates gene expression. This microRNA has been identified in mouse (MI0000156, MI0000408), and in human (MI0000448, MI0000748). miR-130 appears to be vertebrate-specific miRNA and has now been predicted or experimentally confirmed in a range of vertebrate species (MIPF0000034). Mature microRNAs are processed from the precursor stem-loop by the Dicer enzyme. In this case, the mature sequence is excised from the 3' arm of the hairpin. It has been found that miR-130 is upregulated in a type of cancer called hepatocellular carcinoma. It has been shown that miR-130a is expressed in the hematopoietic stem/progenitor cell compartment but not in mature blood cells.

Stem-loop

         ugu   uu       ---        a  -  acc 
5' aagguc   ugc  ugacgau   guugcacu cu ga   a
   ||||||   |||  |||||||   |||||||| || ||   u
3' uuucgg   acg  acuguua   uaacguga ga cu   c
         cuu   uu       uga        c  a  aau 

Confidence

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (GRCz11; GCA_000002035.4): chr5: 13289353-13289433 [+]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from dre-mir-301b

• dre-mir-130c-2: chr5: 13288828-13288908 [+]
• dre-mir-301b: chr5: 13289353-13289433 [+]
• dre-mir-454b: chr5: 13296307-13296422 [+]
• dre-mir-130b: chr5: 13299331-13299414 [+]

Database links

• EntrezGene:mir301b
• EntrezGene:mir301b
• RNAcentral:URS000075DC33_7955
• miRBase Tracker:MI0002061

Mature sequence dre-miR-301b-5p

• Accession: MIMAT0031990
• Sequence: 11 - gcuuugacgauguugcacuac - 31
• Evidence: not experimental
• Database links:
  • RNAcentral:URS000077EB51_7955

Mature sequence dre-miR-301b-3p

• Accession: MIMAT0001871
• Previous IDs: dre-miR-301b
• Sequence: 49 - cagugcaauaguauugucauug - 70
• Evidence: experimental; cloned [1]
• Predicted targets:
  • TargetScanFish:dre-miR-301b

References

1. PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).