Stem-loop sequence dre-mir-301b

Accession MI0002061
Description Danio rerio miR-301b stem-loop
Gene family MIPF0000034; mir-130
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-130_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology, miR-130 microRNA precursor is a small non-coding RNA that regulates gene expression. This microRNA has been identified in mouse (MI0000156, MI0000408), and in human (MI0000448, MI0000748). miR-130 appears to be vertebrate-specific miRNA and has now been predicted or experimentally confirmed in a range of vertebrate species (MIPF0000034). Mature microRNAs are processed from the precursor stem-loop by the Dicer enzyme. In this case, the mature sequence is excised from the 3' arm of the hairpin. It has been found that miR-130 is upregulated in a type of cancer called hepatocellular carcinoma.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
      ugu   uu       ---        a  -  acc 
aagguc   ugc  ugacgau   guugcacu cu ga   a
||||||   |||  |||||||   |||||||| || ||   u
uuucgg   acg  acuguua   uaacguga ga cu   c
      cuu   uu       uga        c  a  aau 
Get sequence
Genome context
Coordinates (Zv9) Overlapping transcripts
5: 14491699-14491779 [+]
intergenic
Clustered miRNAs
< 10kb from dre-mir-301b
dre-mir-130c-2 5: 14491174-14491254 [+]
dre-mir-301b 5: 14491699-14491779 [+]
dre-mir-454b 5: 14498653-14498768 [+]
dre-mir-130b 5: 14501677-14501760 [+]
Database links

Mature sequence dre-miR-301b

Accession MIMAT0001871
Sequence

49 - 

cagugcaauaguauugucauug

 - 70

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).