Stem-loop sequence dre-mir-301b

AccessionMI0002061 (change log)
DescriptionDanio rerio miR-301b stem-loop
Gene family MIPF0000034; mir-130
Literature search

1 open access papers mention dre-mir-301b
(5 sentences)

Stem-loop
         ugu   uu       ---        a  -  acc 
5' aagguc   ugc  ugacgau   guugcacu cu ga   a
   ||||||   |||  |||||||   |||||||| || ||   u
3' uuucgg   acg  acuguua   uaacguga ga cu   c
         cuu   uu       uga        c  a  aau 
Get sequence
Deep sequencing
3554 reads, 130 reads per million, 10 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr5: 13289353-13289433 [+]
intergenic
Clustered miRNAs
< 10kb from dre-mir-301b
dre-mir-130c-2chr5: 13288828-13288908 [+]
dre-mir-301bchr5: 13289353-13289433 [+]
dre-mir-454bchr5: 13296307-13296422 [+]
dre-mir-130bchr5: 13299331-13299414 [+]
Database links

Mature sequence dre-miR-301b-5p

Accession MIMAT0031990
Sequence

11 - 

gcuuugacgauguugcacuac

 - 31

Get sequence
Deep sequencing381 reads, 9 experiments
Evidence not experimental
Database links

Mature sequence dre-miR-301b-3p

Accession MIMAT0001871
Previous IDsdre-miR-301b
Sequence

49 - 

cagugcaauaguauugucauug

 - 70

Get sequence
Deep sequencing3163 reads, 10 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).