Stem-loop sequence dre-mir-338-1

AccessionMI0002063
DescriptionDanio rerio miR-338-1 stem-loop
Gene family MIPF0000097; mir-338
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled miR-338. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-338 is a family of brain-specific microRNA precursors found in mammals, including humans. The ~22 nucleotide mature miRNA sequence is excised from the precursor hairpin by the enzyme Dicer. This sequence then associates with RISC which effects RNA interference. miR-338 is located in an intronic region within the gene for apoptosis-associated tyrosine kinase (AATK). It has been predicted that it may downregulate genes which have a downstream negative effect on AATK expression.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
      -u     cu       uc  -         ccu     uuu 
5' ggu  ucucc  gcaacaa  uc cugaugcug   gagug   u
   |||  |||||  |||||||  || |||||||||   |||||   u
3' cca  ggagg  cguuguu  ag gacuacgac   cucac   c
      cu     -c       uu  u         ---     cuu 
Get sequence
Deep sequencing
430 reads, 60.7 reads per million, 4 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
12: 38062318-38062402 [+]
sense
OTTDART00000048001 ; aatkb-001; intron 7
ENSDART00000111560 ; aatkb-001; intron 7
Database links

Mature sequence dre-miR-338

Accession MIMAT0001873
Sequence

52 - 

uccagcaucagugauuuuguug

 - 73

Get sequence
Deep sequencing567 reads, 4 experiments
Evidence experimental; cloned [1]

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).