Stem-loop sequence dre-mir-363

AccessionMI0002067
DescriptionDanio rerio miR-363 stem-loop
Gene family MIPF0000138; mir-363
Stem-loop
           aa  --uuu    u  u uuuu          a  c         auuag   u ga 
5' uaaaugca  ua     gucu gc g    cggguggaug cu ugcaauuuu     uga g  a
   ||||||||  ||     |||| || |    |||||||||| || |||||||||     ||| |   
3' guuugcgu  au     uagg cg c    gucuaccuau gg acguuaaaa     acu c  a
           cc  uaccu    u  c uaau          -  c         --aua   u aa 
Get sequence
Deep sequencing
9152 reads, 922 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
14: 32336550-32336676 [-]
intergenic
Clustered miRNAs
< 10kb from dre-mir-363
dre-mir-18c14: 32337255-32337339 [-]
dre-mir-20b14: 32337046-32337139 [-]
dre-mir-19c14: 32336905-32337009 [-]
dre-mir-36314: 32336550-32336676 [-]
Database links

Mature sequence dre-miR-363-5p

Accession MIMAT0031992
Sequence

29 - 

cggguggaugacucugcaauuuu

 - 51

Get sequence
Deep sequencing187 reads, 3 experiments
Evidence not experimental

Mature sequence dre-miR-363-3p

Accession MIMAT0001874
Previous IDsdre-miR-363
Sequence

78 - 

aauugcacgguauccaucugua

 - 99

Get sequence
Deep sequencing6605 reads, 4 experiments
Evidence experimental; cloned [1]

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).