Stem-loop sequence dre-mir-365-1

AccessionMI0002068 (change log)
DescriptionDanio rerio miR-365-1 stem-loop
Gene family MIPF0000061; mir-365
Stem-loop
   --cc      ag        gc           c     uuucag 
5'     gcaggg  aaugaggg  uuuugggggca uugug      u
       ||||||  ||||||||  ||||||||||| |||||      u
3'     cguucu  uuauuccu  aaaauccccgu aauac      u
   guca      cg        -a           -     uaccac 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr3: 43716827-43716915 [+]
sense
OTTDART00000053888 ; si:ch73-156l6.2-001; intron 1
ENSDART00000155441 ; si:ch73-156l6.2-001; intron 1
Clustered miRNAs
< 10kb from dre-mir-365-1
dre-mir-193bchr3: 43714699-43714783 [+]
dre-mir-365-1chr3: 43716827-43716915 [+]
Database links

Mature sequence dre-miR-365

Accession MIMAT0001875
Sequence

55 - 

uaaugccccuaaaaauccuuau

 - 76

Get sequence
Evidence by similarity; MI0000768
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).