Stem-loop sequence dre-mir-365-2

AccessionMI0002069
DescriptionDanio rerio miR-365-2 stem-loop
Gene family MIPF0000061; mir-365
Stem-loop
   -----aggca      aa        ac           -----    u   u 
5'           gcaaga  aaugaggg  uuuuaggggca     gcug guu u
             ||||||  ||||||||  |||||||||||     |||| ||| a
3'           cguucu  uuauuccu  aaaauccccgu     ugac caa u
   cgacuuuuaa      cg        -a           aauac    c   u 
Get sequence
Deep sequencing
12 reads, 12.3 reads per million, 2 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
3: 44211652-44211749 [+]
intergenic
Clustered miRNAs
< 10kb from dre-mir-365-2
dre-mir-193a-13: 44210575-44210673 [+]
dre-mir-365-23: 44211652-44211749 [+]
Database links

Mature sequence dre-miR-365

Accession MIMAT0001875
Sequence

58 - 

uaaugccccuaaaaauccuuau

 - 79

Get sequence
Deep sequencing8 reads, 2 experiments
Evidence by similarity; MI0000768

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).