Stem-loop sequence dre-mir-454a

AccessionMI0002074
Previous IDsdre-mir-454a-1
DescriptionDanio rerio miR-454a stem-loop
Gene family MIPF0000174; mir-454
Stem-loop
   u  c    -  uuuaagaauuaau     uu             ---         cu     gucca   u 
5'  ug aggu cg             ccuaa  cuugggacccuau   caguauugc  cugcu     cug g
    || |||| ||             |||||  |||||||||||||   |||||||||  |||||     |||  
3'  ac ucca gu             ggauu  ggauuuugggaua   guuauaacg  gauga     gac u
   g  u    u  ------------u     uu             auc         -u     -----   u 
Get sequence
Deep sequencing
2434 reads, 325 reads per million, 4 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
10: 34404993-34405116 [-]
sense
ENSDART00000023509 ; SKA2-201; intron 1
Clustered miRNAs
< 10kb from dre-mir-454a
dre-mir-130a10: 34405305-34405389 [-]
dre-mir-301a10: 34405176-34405261 [-]
dre-mir-454a10: 34404993-34405116 [-]
Database links

Mature sequence dre-miR-454a

Accession MIMAT0001877
Sequence

77 - 

uagugcaauauugcuaauaggg

 - 98

Get sequence
Deep sequencing2146 reads, 4 experiments
Evidence experimental; cloned [1]

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).