Stem-loop sequence dre-mir-454b

AccessionMI0002076 (change log)
DescriptionDanio rerio miR-454b stem-loop
Gene family MIPF0000174; mir-454
Stem-loop
       aa    ------     c  g           ---         cu       ucuca 
5' gaua  ugca      ucuug ag cgagacccuau   caauauugc  cugcuuu     c
   ||||  ||||      ||||| || |||||||||||   |||||||||  |||||||     u
3' cuau  acgu      ggaau uc guucugggaua   guuauaacg  gaugagg     g
       -a    cuaauc     u  a           uuc         -u       uauuu 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr5: 13296307-13296422 [+]
intergenic
Clustered miRNAs
< 10kb from dre-mir-454b
dre-mir-130c-2chr5: 13288828-13288908 [+]
dre-mir-301bchr5: 13289353-13289433 [+]
dre-mir-454bchr5: 13296307-13296422 [+]
dre-mir-130bchr5: 13299331-13299414 [+]
Database links

Mature sequence dre-miR-454b

Accession MIMAT0001878
Sequence

66 - 

uagugcaauauugcuuauaggg

 - 87

Get sequence
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).