Stem-loop sequence dre-mir-455-1

AccessionMI0002077 (change log)
Previous IDsdre-mir-455a
DescriptionDanio rerio miR-455-1 stem-loop
Gene family MIPF0000129; mir-455
Stem-loop
   ---ucc  -   -g     -----          u      a   c   gaa 
5'       cu ggu  ugagg     guaugugccc uggacu cau gug   g
         || |||  |||||     |||||||||| |||||| ||| |||    
3'       ga ccg  acucc     cauauacggg accuga gua cac   c
   cuucua  u   ga     guuca          u      c   c   gac 
Get sequence
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mir-455 precursor was predicted computationally and a mature product verified in human by Northern blot [2]. The precise sequence termini of the mature form were derived by cloning from human and rat samples (Landgraf and Tuschl, unpublished).

Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr5: 65250379-65250474 [-]
sense
OTTDART00000023198 ; si:ch211-233f10.5-001; intron 3
ENSDART00000137363 ; col27a1b-001; intron 3
ENSDART00000097297 ; col27a1b-201; intron 8
KZ115158.1: 169526-169621 [-]
sense
OTTDART00000023198 ; si:ch211-233f10.5-001; intron 3
ENSDART00000137363 ; col27a1b-001; intron 3
ENSDART00000097297 ; col27a1b-201; intron 8
Database links

Mature sequence dre-miR-455-5p

Accession MIMAT0001879
Previous IDsdre-miR-455a
Sequence

16 - 

uaugugcccuuggacuacaucg

 - 37

Get sequence
Evidence by similarity; MI0003513
Database links
Predicted targets

Mature sequence dre-miR-455-3p

Accession MIMAT0031993
Sequence

52 - 

augcaguccaugggcauauacac

 - 74

Get sequence
Evidence not experimental

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).
2
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).