Stem-loop sequence dre-mir-430c-3

AccessionMI0002080 (change log)
DescriptionDanio rerio miR-430c-3 stem-loop
Gene family MIPF0000003; mir-430
Literature search

38 open access papers mention dre-mir-430c-3
(193 sentences)

Stem-loop
           c        c         gauu  ucc 
5' auuaagau acuucaaa aggagcauu    ug   u
   |||||||| |||||||| |||||||||    ||   u
3' uaauuuug ugggguuu ucuucguga    ac   u
           a        c         --au  uug 
Get sequence
Deep sequencing
4084952 reads, 1.34e+05 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr4: 28695113-28695185 [+]
sense
ENSDART00000129108 ; dre-mir-430c-18.5-201; exon 1
Clustered miRNAs
< 10kb from dre-mir-430c-3
dre-mir-430a-18chr4: 28693199-28693288 [+]
dre-mir-430c-1chr4: 28693371-28693443 [+]
dre-mir-430b-4chr4: 28693628-28693708 [+]
dre-mir-430a-4chr4: 28693834-28693915 [+]
dre-mir-430c-2chr4: 28693975-28694047 [+]
dre-mir-430b-5chr4: 28694219-28694299 [+]
dre-mir-430a-2chr4: 28694950-28695031 [+]
dre-mir-430c-3chr4: 28695113-28695185 [+]
dre-mir-430b-10chr4: 28695370-28695450 [+]
dre-mir-430a-12chr4: 28695576-28695657 [+]
dre-mir-430c-4chr4: 28695717-28695789 [+]
dre-mir-430b-1chr4: 28695960-28696040 [+]
dre-mir-430a-3chr4: 28696691-28696772 [+]
dre-mir-430c-5chr4: 28696854-28696926 [+]
dre-mir-430b-6chr4: 28697111-28697191 [+]
dre-mir-430a-13chr4: 28697317-28697398 [+]
dre-mir-430c-6chr4: 28697458-28697530 [+]
dre-mir-430b-11chr4: 28697715-28697795 [+]
dre-mir-430a-16chr4: 28697921-28698002 [+]
dre-mir-430b-9chr4: 28698305-28698385 [+]
dre-mir-430a-5chr4: 28699035-28699116 [+]
dre-mir-430c-7chr4: 28699198-28699270 [+]
dre-mir-430b-12chr4: 28699455-28699535 [+]
dre-mir-430i-1chr4: 28699661-28699742 [+]
dre-mir-430c-8chr4: 28699824-28699896 [+]
dre-mir-430b-2chr4: 28700067-28700147 [+]
dre-mir-430a-6chr4: 28700798-28700879 [+]
dre-mir-430c-9chr4: 28700961-28701033 [+]
dre-mir-430b-7chr4: 28701218-28701298 [+]
dre-mir-430a-11chr4: 28701424-28701505 [+]
dre-mir-430c-10chr4: 28701587-28701659 [+]
dre-mir-430b-13chr4: 28701844-28701924 [+]
dre-mir-430i-2chr4: 28702050-28702131 [+]
dre-mir-430c-11chr4: 28702213-28702285 [+]
dre-mir-430b-18chr4: 28702456-28702536 [+]
dre-mir-430a-7chr4: 28703187-28703268 [+]
dre-mir-430c-12chr4: 28703350-28703422 [+]
dre-mir-430b-14chr4: 28703607-28703687 [+]
dre-mir-430a-17chr4: 28703813-28703894 [+]
dre-mir-430b-20chr4: 28704197-28704277 [+]
dre-mir-430a-8chr4: 28704927-28705008 [+]
dre-mir-430c-13chr4: 28705090-28705162 [+]
Database links

Mature sequence dre-miR-430c-5p

Accession MIMAT0031929
Sequence

9 - 

cacuucaaacaggagcauuga

 - 29

Get sequence
Deep sequencing1083150 reads, 5 experiments
Evidence not experimental

Mature sequence dre-miR-430c-3p

Accession MIMAT0001425
Previous IDsdre-miR-430c
Sequence

45 - 

uaagugcuucucuuugggguag

 - 66

Get sequence
Deep sequencing72445590 reads, 5 experiments
Evidence experimental; cloned [1-2]
Database links
Predicted targets

References

1
PMID:15774722 "MicroRNAs regulate brain morphogenesis in zebrafish" Giraldez AJ, Cinalli RM, Glasner ME, Enright AJ, Thomson JM, Baskerville S, Hammond SM, Bartel DP, Schier AF Science. 308:833-838(2005).
2
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).