Stem-loop sequence dre-mir-430c-12

AccessionMI0002092
Previous IDsdre-mir-430c-15
DescriptionDanio rerio miR-430c-12 stem-loop
Gene family MIPF0000003; mir-430
Stem-loop
           c        c         gauu  ucc 
5' auuaagau acuucaaa aggagcauu    ug   u
   |||||||| |||||||| |||||||||    ||   u
3' uaauuuug ugggguuu ucuucguga    ac   u
           a        c         --au  uug 
Get sequence
Deep sequencing
2651 reads, 394 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
4: 28010901-28010973 [+]
sense
ENSDART00000130223 ; dre-mir-430c-18.10-201; exon 1
Clustered miRNAs
< 10kb from dre-mir-430c-12
dre-mir-430c-14: 28000922-28000994 [+]
dre-mir-430b-44: 28001179-28001259 [+]
dre-mir-430a-44: 28001385-28001466 [+]
dre-mir-430c-24: 28001526-28001598 [+]
dre-mir-430b-54: 28001770-28001850 [+]
dre-mir-430a-24: 28002501-28002582 [+]
dre-mir-430c-34: 28002664-28002736 [+]
dre-mir-430b-104: 28002921-28003001 [+]
dre-mir-430a-124: 28003127-28003208 [+]
dre-mir-430c-44: 28003268-28003340 [+]
dre-mir-430b-14: 28003511-28003591 [+]
dre-mir-430a-34: 28004242-28004323 [+]
dre-mir-430c-54: 28004405-28004477 [+]
dre-mir-430b-64: 28004662-28004742 [+]
dre-mir-430a-134: 28004868-28004949 [+]
dre-mir-430c-64: 28005009-28005081 [+]
dre-mir-430b-114: 28005266-28005346 [+]
dre-mir-430a-164: 28005472-28005553 [+]
dre-mir-430b-94: 28005856-28005936 [+]
dre-mir-430a-54: 28006586-28006667 [+]
dre-mir-430c-74: 28006749-28006821 [+]
dre-mir-430b-124: 28007006-28007086 [+]
dre-mir-430i-14: 28007212-28007293 [+]
dre-mir-430c-84: 28007375-28007447 [+]
dre-mir-430b-24: 28007618-28007698 [+]
dre-mir-430a-64: 28008349-28008430 [+]
dre-mir-430c-94: 28008512-28008584 [+]
dre-mir-430b-74: 28008769-28008849 [+]
dre-mir-430a-114: 28008975-28009056 [+]
dre-mir-430c-104: 28009138-28009210 [+]
dre-mir-430b-134: 28009395-28009475 [+]
dre-mir-430i-24: 28009601-28009682 [+]
dre-mir-430c-114: 28009764-28009836 [+]
dre-mir-430b-184: 28010007-28010087 [+]
dre-mir-430a-74: 28010738-28010819 [+]
dre-mir-430c-124: 28010901-28010973 [+]
dre-mir-430b-144: 28011158-28011238 [+]
dre-mir-430a-174: 28011364-28011445 [+]
dre-mir-430b-204: 28011748-28011828 [+]
dre-mir-430a-84: 28012478-28012559 [+]
dre-mir-430c-134: 28012641-28012713 [+]
dre-mir-430b-154: 28012898-28012978 [+]
dre-mir-430i-34: 28013104-28013185 [+]
dre-mir-430c-144: 28013267-28013339 [+]
dre-mir-430b-194: 28013510-28013590 [+]
dre-mir-430a-94: 28014241-28014322 [+]
dre-mir-430c-154: 28014404-28014476 [+]
dre-mir-430b-164: 28014661-28014741 [+]
dre-mir-430a-144: 28014867-28014948 [+]
dre-mir-430c-164: 28015008-28015080 [+]
dre-mir-430b-34: 28015251-28015331 [+]
dre-mir-430a-104: 28015981-28016062 [+]
dre-mir-430c-174: 28016144-28016216 [+]
dre-mir-430b-84: 28016401-28016481 [+]
dre-mir-430a-154: 28016607-28016688 [+]
dre-mir-430c-184: 28016748-28016820 [+]
dre-mir-430b-174: 28017005-28017085 [+]
Database links

Mature sequence dre-miR-430c-5p

Accession MIMAT0031929
Sequence

9 - 

cacuucaaacaggagcauuga

 - 29

Get sequence
Deep sequencing40101 reads, 5 experiments
Evidence not experimental

Mature sequence dre-miR-430c-3p

Accession MIMAT0001425
Previous IDsdre-miR-430c
Sequence

45 - 

uaagugcuucucuuugggguag

 - 66

Get sequence
Deep sequencing2120135 reads, 4 experiments
Evidence experimental; cloned [1-2]
Validated targets

References

1
PMID:15774722 "MicroRNAs regulate brain morphogenesis in zebrafish" Giraldez AJ, Cinalli RM, Glasner ME, Enright AJ, Thomson JM, Baskerville S, Hammond SM, Bartel DP, Schier AF Science. 308:833-838(2005).
2
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).