Stem-loop sequence dre-mir-430a-12

AccessionMI0002121 (change log)
DescriptionDanio rerio miR-430a-12 stem-loop
Gene family MIPF0000003; mir-430
Literature search

38 open access papers mention dre-mir-430a-12
(202 sentences)

Stem-loop
      u  -auc g      c     -      g   uu      
5' guc cu    g uacccu acaaa agcacu acu  gaugc 
   ||| ||    | |||||| ||||| |||||| |||  |||| u
3' cag ga    u augggg uguuu ucguga ugg  uuaug 
      u  acuu g      u     a      a   -u      
Get sequence
Deep sequencing
2843105 reads, 9.63e+04 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr4: 28695576-28695657 [+]
intergenic
Clustered miRNAs
< 10kb from dre-mir-430a-12
dre-mir-430a-18chr4: 28693199-28693288 [+]
dre-mir-430c-1chr4: 28693371-28693443 [+]
dre-mir-430b-4chr4: 28693628-28693708 [+]
dre-mir-430a-4chr4: 28693834-28693915 [+]
dre-mir-430c-2chr4: 28693975-28694047 [+]
dre-mir-430b-5chr4: 28694219-28694299 [+]
dre-mir-430a-2chr4: 28694950-28695031 [+]
dre-mir-430c-3chr4: 28695113-28695185 [+]
dre-mir-430b-10chr4: 28695370-28695450 [+]
dre-mir-430a-12chr4: 28695576-28695657 [+]
dre-mir-430c-4chr4: 28695717-28695789 [+]
dre-mir-430b-1chr4: 28695960-28696040 [+]
dre-mir-430a-3chr4: 28696691-28696772 [+]
dre-mir-430c-5chr4: 28696854-28696926 [+]
dre-mir-430b-6chr4: 28697111-28697191 [+]
dre-mir-430a-13chr4: 28697317-28697398 [+]
dre-mir-430c-6chr4: 28697458-28697530 [+]
dre-mir-430b-11chr4: 28697715-28697795 [+]
dre-mir-430a-16chr4: 28697921-28698002 [+]
dre-mir-430b-9chr4: 28698305-28698385 [+]
dre-mir-430a-5chr4: 28699035-28699116 [+]
dre-mir-430c-7chr4: 28699198-28699270 [+]
dre-mir-430b-12chr4: 28699455-28699535 [+]
dre-mir-430i-1chr4: 28699661-28699742 [+]
dre-mir-430c-8chr4: 28699824-28699896 [+]
dre-mir-430b-2chr4: 28700067-28700147 [+]
dre-mir-430a-6chr4: 28700798-28700879 [+]
dre-mir-430c-9chr4: 28700961-28701033 [+]
dre-mir-430b-7chr4: 28701218-28701298 [+]
dre-mir-430a-11chr4: 28701424-28701505 [+]
dre-mir-430c-10chr4: 28701587-28701659 [+]
dre-mir-430b-13chr4: 28701844-28701924 [+]
dre-mir-430i-2chr4: 28702050-28702131 [+]
dre-mir-430c-11chr4: 28702213-28702285 [+]
dre-mir-430b-18chr4: 28702456-28702536 [+]
dre-mir-430a-7chr4: 28703187-28703268 [+]
dre-mir-430c-12chr4: 28703350-28703422 [+]
dre-mir-430b-14chr4: 28703607-28703687 [+]
dre-mir-430a-17chr4: 28703813-28703894 [+]
dre-mir-430b-20chr4: 28704197-28704277 [+]
dre-mir-430a-8chr4: 28704927-28705008 [+]
dre-mir-430c-13chr4: 28705090-28705162 [+]
dre-mir-430b-15chr4: 28705347-28705427 [+]
dre-mir-430i-3chr4: 28705553-28705634 [+]
Database links

Mature sequence dre-miR-430a-12-5p

Accession MIMAT0031997
Sequence

13 - 

acccucacaaaagcacugacu

 - 33

Get sequence
Deep sequencing5258 reads, 5 experiments
Evidence not experimental

Mature sequence dre-miR-430a-3p

Accession MIMAT0001423
Previous IDsdre-miR-430a
Sequence

50 - 

uaagugcuauuuguugggguag

 - 71

Get sequence
Deep sequencing51077825 reads, 5 experiments
Evidence experimental; cloned [1-2]
Database links
Predicted targets

References

1
PMID:15774722 "MicroRNAs regulate brain morphogenesis in zebrafish" Giraldez AJ, Cinalli RM, Glasner ME, Enright AJ, Thomson JM, Baskerville S, Hammond SM, Bartel DP, Schier AF Science. 308:833-838(2005).
2
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).