Stem-loop sequence dre-mir-430a-17

AccessionMI0002126
DescriptionDanio rerio miR-430a-17 stem-loop
Gene family MIPF0000003; mir-430
Stem-loop
      u  -auc g      c     -      g   uu      
5' guc cu    g uacccu acaaa agcacu acu  gaugc 
   ||| ||    | |||||| ||||| |||||| |||  |||| u
3' cag ga    u augggg uguuu ucguga ugg  uuaug 
      u  auuu g      u     a      a   -u      
Get sequence
Deep sequencing
11327 reads, 614 reads per million, 4 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
4: 28011364-28011445 [+]
sense
ENSDART00000115586 ; dre-mir-430a-17.2-201; exon 1
Clustered miRNAs
< 10kb from dre-mir-430a-17
dre-mir-430a-44: 28001385-28001466 [+]
dre-mir-430c-24: 28001526-28001598 [+]
dre-mir-430b-54: 28001770-28001850 [+]
dre-mir-430a-24: 28002501-28002582 [+]
dre-mir-430c-34: 28002664-28002736 [+]
dre-mir-430b-104: 28002921-28003001 [+]
dre-mir-430a-124: 28003127-28003208 [+]
dre-mir-430c-44: 28003268-28003340 [+]
dre-mir-430b-14: 28003511-28003591 [+]
dre-mir-430a-34: 28004242-28004323 [+]
dre-mir-430c-54: 28004405-28004477 [+]
dre-mir-430b-64: 28004662-28004742 [+]
dre-mir-430a-134: 28004868-28004949 [+]
dre-mir-430c-64: 28005009-28005081 [+]
dre-mir-430b-114: 28005266-28005346 [+]
dre-mir-430a-164: 28005472-28005553 [+]
dre-mir-430b-94: 28005856-28005936 [+]
dre-mir-430a-54: 28006586-28006667 [+]
dre-mir-430c-74: 28006749-28006821 [+]
dre-mir-430b-124: 28007006-28007086 [+]
dre-mir-430i-14: 28007212-28007293 [+]
dre-mir-430c-84: 28007375-28007447 [+]
dre-mir-430b-24: 28007618-28007698 [+]
dre-mir-430a-64: 28008349-28008430 [+]
dre-mir-430c-94: 28008512-28008584 [+]
dre-mir-430b-74: 28008769-28008849 [+]
dre-mir-430a-114: 28008975-28009056 [+]
dre-mir-430c-104: 28009138-28009210 [+]
dre-mir-430b-134: 28009395-28009475 [+]
dre-mir-430i-24: 28009601-28009682 [+]
dre-mir-430c-114: 28009764-28009836 [+]
dre-mir-430b-184: 28010007-28010087 [+]
dre-mir-430a-74: 28010738-28010819 [+]
dre-mir-430c-124: 28010901-28010973 [+]
dre-mir-430b-144: 28011158-28011238 [+]
dre-mir-430a-174: 28011364-28011445 [+]
dre-mir-430b-204: 28011748-28011828 [+]
dre-mir-430a-84: 28012478-28012559 [+]
dre-mir-430c-134: 28012641-28012713 [+]
dre-mir-430b-154: 28012898-28012978 [+]
dre-mir-430i-34: 28013104-28013185 [+]
dre-mir-430c-144: 28013267-28013339 [+]
dre-mir-430b-194: 28013510-28013590 [+]
dre-mir-430a-94: 28014241-28014322 [+]
dre-mir-430c-154: 28014404-28014476 [+]
dre-mir-430b-164: 28014661-28014741 [+]
dre-mir-430a-144: 28014867-28014948 [+]
dre-mir-430c-164: 28015008-28015080 [+]
dre-mir-430b-34: 28015251-28015331 [+]
dre-mir-430a-104: 28015981-28016062 [+]
dre-mir-430c-174: 28016144-28016216 [+]
dre-mir-430b-84: 28016401-28016481 [+]
dre-mir-430a-154: 28016607-28016688 [+]
dre-mir-430c-184: 28016748-28016820 [+]
dre-mir-430b-174: 28017005-28017085 [+]
Database links

Mature sequence dre-miR-430a-17-5p

Accession MIMAT0032002
Sequence

13 - 

acccucacaaaagcacugacu

 - 33

Get sequence
Evidence not experimental

Mature sequence dre-miR-430a-3p

Accession MIMAT0001423
Previous IDsdre-miR-430a
Sequence

50 - 

uaagugcuauuuguugggguag

 - 71

Get sequence
Deep sequencing1361706 reads, 4 experiments
Evidence experimental; cloned [1-2]
Validated targets

References

1
PMID:15774722 "MicroRNAs regulate brain morphogenesis in zebrafish" Giraldez AJ, Cinalli RM, Glasner ME, Enright AJ, Thomson JM, Baskerville S, Hammond SM, Bartel DP, Schier AF Science. 308:833-838(2005).
2
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).