Stem-loop sequence dre-mir-430a-18

AccessionMI0002131
Previous IDsdre-mir-430a-22
DescriptionDanio rerio miR-430a-18 stem-loop
Gene family MIPF0000003; mir-430
Stem-loop
   gucaggcuuucacaagcca       aguuuguucucaaacuuuaag 
5'                    gccucaa                     a
                      |||||||                     a
3'                    ugggguu                     u
   -------agugaacuuuga       guuuaucgugaaugguugauc 
Get sequence
Deep sequencing
41050 reads, 2.94e+03 reads per million, 4 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
4: 28000750-28000839 [+]
sense
ENSDART00000116417 ; dre-mir-430a-18.1-201; exon 1
Clustered miRNAs
< 10kb from dre-mir-430a-18
dre-mir-430a-184: 28000750-28000839 [+]
dre-mir-430c-14: 28000922-28000994 [+]
dre-mir-430b-44: 28001179-28001259 [+]
dre-mir-430a-44: 28001385-28001466 [+]
dre-mir-430c-24: 28001526-28001598 [+]
dre-mir-430b-54: 28001770-28001850 [+]
dre-mir-430a-24: 28002501-28002582 [+]
dre-mir-430c-34: 28002664-28002736 [+]
dre-mir-430b-104: 28002921-28003001 [+]
dre-mir-430a-124: 28003127-28003208 [+]
dre-mir-430c-44: 28003268-28003340 [+]
dre-mir-430b-14: 28003511-28003591 [+]
dre-mir-430a-34: 28004242-28004323 [+]
dre-mir-430c-54: 28004405-28004477 [+]
dre-mir-430b-64: 28004662-28004742 [+]
dre-mir-430a-134: 28004868-28004949 [+]
dre-mir-430c-64: 28005009-28005081 [+]
dre-mir-430b-114: 28005266-28005346 [+]
dre-mir-430a-164: 28005472-28005553 [+]
dre-mir-430b-94: 28005856-28005936 [+]
dre-mir-430a-54: 28006586-28006667 [+]
dre-mir-430c-74: 28006749-28006821 [+]
dre-mir-430b-124: 28007006-28007086 [+]
dre-mir-430i-14: 28007212-28007293 [+]
dre-mir-430c-84: 28007375-28007447 [+]
dre-mir-430b-24: 28007618-28007698 [+]
dre-mir-430a-64: 28008349-28008430 [+]
dre-mir-430c-94: 28008512-28008584 [+]
dre-mir-430b-74: 28008769-28008849 [+]
dre-mir-430a-114: 28008975-28009056 [+]
dre-mir-430c-104: 28009138-28009210 [+]
dre-mir-430b-134: 28009395-28009475 [+]
dre-mir-430i-24: 28009601-28009682 [+]
dre-mir-430c-114: 28009764-28009836 [+]
dre-mir-430b-184: 28010007-28010087 [+]
dre-mir-430a-74: 28010738-28010819 [+]
Database links

Mature sequence dre-miR-430a-3p

Accession MIMAT0001423
Previous IDsdre-miR-430a
Sequence

59 - 

uaagugcuauuuguugggguag

 - 80

Get sequence
Deep sequencing1361706 reads, 4 experiments
Evidence experimental; cloned [1-2]
Validated targets

References

1
PMID:15774722 "MicroRNAs regulate brain morphogenesis in zebrafish" Giraldez AJ, Cinalli RM, Glasner ME, Enright AJ, Thomson JM, Baskerville S, Hammond SM, Bartel DP, Schier AF Science. 308:833-838(2005).
2
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).