Stem-loop sequence dre-mir-430a-18

AccessionMI0002131 (change log)
Previous IDsdre-mir-430a-22
DescriptionDanio rerio miR-430a-18 stem-loop
Gene family MIPF0000003; mir-430
Literature search

38 open access papers mention dre-mir-430a-18
(202 sentences)

   ----------------gucaggcuuucacaa      ------  c        u 
5'                                gccagc      cu aaaguuug u
                                  ||||||      || ||||||||  
3'                                ugguug      ga uuucaaac c
   agugaacuuugaugggguuguuuaucgugaa      aucuaa  a        u 
Get sequence
Deep sequencing
2837602 reads, 9.48e+04 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr4: 28693199-28693288 [+]
ENSDART00000116417 ; dre-mir-430a-18.1-201; exon 1
Clustered miRNAs
< 10kb from dre-mir-430a-18
dre-mir-430a-18chr4: 28693199-28693288 [+]
dre-mir-430c-1chr4: 28693371-28693443 [+]
dre-mir-430b-4chr4: 28693628-28693708 [+]
dre-mir-430a-4chr4: 28693834-28693915 [+]
dre-mir-430c-2chr4: 28693975-28694047 [+]
dre-mir-430b-5chr4: 28694219-28694299 [+]
dre-mir-430a-2chr4: 28694950-28695031 [+]
dre-mir-430c-3chr4: 28695113-28695185 [+]
dre-mir-430b-10chr4: 28695370-28695450 [+]
dre-mir-430a-12chr4: 28695576-28695657 [+]
dre-mir-430c-4chr4: 28695717-28695789 [+]
dre-mir-430b-1chr4: 28695960-28696040 [+]
dre-mir-430a-3chr4: 28696691-28696772 [+]
dre-mir-430c-5chr4: 28696854-28696926 [+]
dre-mir-430b-6chr4: 28697111-28697191 [+]
dre-mir-430a-13chr4: 28697317-28697398 [+]
dre-mir-430c-6chr4: 28697458-28697530 [+]
dre-mir-430b-11chr4: 28697715-28697795 [+]
dre-mir-430a-16chr4: 28697921-28698002 [+]
dre-mir-430b-9chr4: 28698305-28698385 [+]
dre-mir-430a-5chr4: 28699035-28699116 [+]
dre-mir-430c-7chr4: 28699198-28699270 [+]
dre-mir-430b-12chr4: 28699455-28699535 [+]
dre-mir-430i-1chr4: 28699661-28699742 [+]
dre-mir-430c-8chr4: 28699824-28699896 [+]
dre-mir-430b-2chr4: 28700067-28700147 [+]
dre-mir-430a-6chr4: 28700798-28700879 [+]
dre-mir-430c-9chr4: 28700961-28701033 [+]
dre-mir-430b-7chr4: 28701218-28701298 [+]
dre-mir-430a-11chr4: 28701424-28701505 [+]
dre-mir-430c-10chr4: 28701587-28701659 [+]
dre-mir-430b-13chr4: 28701844-28701924 [+]
dre-mir-430i-2chr4: 28702050-28702131 [+]
dre-mir-430c-11chr4: 28702213-28702285 [+]
dre-mir-430b-18chr4: 28702456-28702536 [+]
dre-mir-430a-7chr4: 28703187-28703268 [+]
Database links

Mature sequence dre-miR-430a-3p

Accession MIMAT0001423
Previous IDsdre-miR-430a

59 - 


 - 80

Get sequence
Deep sequencing51077825 reads, 5 experiments
Evidence experimental; cloned [1-2]
Database links
Predicted targets


PMID:15774722 "MicroRNAs regulate brain morphogenesis in zebrafish" Giraldez AJ, Cinalli RM, Glasner ME, Enright AJ, Thomson JM, Baskerville S, Hammond SM, Bartel DP, Schier AF Science. 308:833-838(2005).
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).