Stem-loop sequence dre-mir-430b-3

AccessionMI0002143
DescriptionDanio rerio miR-430b-3 stem-loop
Gene family MIPF0000003; mir-430
Stem-loop
       u  g   a          --     u      uuuaa 
5' cagu ga guc acucuaacuu  uagca cuuucu     g
   |||| || ||| ||||||||||  ||||| ||||||      
3' gucg uu uag ugggguugaa  aucgu gaaaga     c
       u  g   a          cu     -      ugaaa 
Get sequence
Deep sequencing
31443 reads, 5.61e+03 reads per million, 5 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
4: 28015251-28015331 [+]
sense
ENSDART00000125183 ; BX088538.2-201; exon 1
Clustered miRNAs
< 10kb from dre-mir-430b-3
dre-mir-430b-114: 28005266-28005346 [+]
dre-mir-430a-164: 28005472-28005553 [+]
dre-mir-430b-94: 28005856-28005936 [+]
dre-mir-430a-54: 28006586-28006667 [+]
dre-mir-430c-74: 28006749-28006821 [+]
dre-mir-430b-124: 28007006-28007086 [+]
dre-mir-430i-14: 28007212-28007293 [+]
dre-mir-430c-84: 28007375-28007447 [+]
dre-mir-430b-24: 28007618-28007698 [+]
dre-mir-430a-64: 28008349-28008430 [+]
dre-mir-430c-94: 28008512-28008584 [+]
dre-mir-430b-74: 28008769-28008849 [+]
dre-mir-430a-114: 28008975-28009056 [+]
dre-mir-430c-104: 28009138-28009210 [+]
dre-mir-430b-134: 28009395-28009475 [+]
dre-mir-430i-24: 28009601-28009682 [+]
dre-mir-430c-114: 28009764-28009836 [+]
dre-mir-430b-184: 28010007-28010087 [+]
dre-mir-430a-74: 28010738-28010819 [+]
dre-mir-430c-124: 28010901-28010973 [+]
dre-mir-430b-144: 28011158-28011238 [+]
dre-mir-430a-174: 28011364-28011445 [+]
dre-mir-430b-204: 28011748-28011828 [+]
dre-mir-430a-84: 28012478-28012559 [+]
dre-mir-430c-134: 28012641-28012713 [+]
dre-mir-430b-154: 28012898-28012978 [+]
dre-mir-430i-34: 28013104-28013185 [+]
dre-mir-430c-144: 28013267-28013339 [+]
dre-mir-430b-194: 28013510-28013590 [+]
dre-mir-430a-94: 28014241-28014322 [+]
dre-mir-430c-154: 28014404-28014476 [+]
dre-mir-430b-164: 28014661-28014741 [+]
dre-mir-430a-144: 28014867-28014948 [+]
dre-mir-430c-164: 28015008-28015080 [+]
dre-mir-430b-34: 28015251-28015331 [+]
dre-mir-430a-104: 28015981-28016062 [+]
dre-mir-430c-174: 28016144-28016216 [+]
dre-mir-430b-84: 28016401-28016481 [+]
dre-mir-430a-154: 28016607-28016688 [+]
dre-mir-430c-184: 28016748-28016820 [+]
dre-mir-430b-174: 28017005-28017085 [+]
Database links

Mature sequence dre-miR-430b-5p

Accession MIMAT0031928
Sequence

11 - 

caacucuaacuuuagcaucuuuc

 - 33

Get sequence
Deep sequencing12291 reads, 4 experiments
Evidence not experimental

Mature sequence dre-miR-430b-3p

Accession MIMAT0001424
Previous IDsdre-miR-430b
Sequence

49 - 

aaagugcuaucaaguugggguag

 - 71

Get sequence
Deep sequencing6120103 reads, 5 experiments
Evidence experimental; cloned [1-2]
Validated targets

References

1
PMID:15774722 "MicroRNAs regulate brain morphogenesis in zebrafish" Giraldez AJ, Cinalli RM, Glasner ME, Enright AJ, Thomson JM, Baskerville S, Hammond SM, Bartel DP, Schier AF Science. 308:833-838(2005).
2
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).