Stem-loop sequence dre-mir-430b-7

AccessionMI0002147 (change log)
DescriptionDanio rerio miR-430b-7 stem-loop
Gene family MIPF0000003; mir-430
Stem-loop
       u      a          --     u      -   a 
5' cagu gacguc acucuaacuu  uagca cuuucu uuu a
   |||| |||||| ||||||||||  ||||| |||||| ||| g
3' gucg uuguag ugggguugaa  aucgu gaaaga gag c
       u      a          cu     -      u   a 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr4: 28701218-28701298 [+]
intergenic
Clustered miRNAs
< 10kb from dre-mir-430b-7
dre-mir-430a-18chr4: 28693199-28693288 [+]
dre-mir-430c-1chr4: 28693371-28693443 [+]
dre-mir-430b-4chr4: 28693628-28693708 [+]
dre-mir-430a-4chr4: 28693834-28693915 [+]
dre-mir-430c-2chr4: 28693975-28694047 [+]
dre-mir-430b-5chr4: 28694219-28694299 [+]
dre-mir-430a-2chr4: 28694950-28695031 [+]
dre-mir-430c-3chr4: 28695113-28695185 [+]
dre-mir-430b-10chr4: 28695370-28695450 [+]
dre-mir-430a-12chr4: 28695576-28695657 [+]
dre-mir-430c-4chr4: 28695717-28695789 [+]
dre-mir-430b-1chr4: 28695960-28696040 [+]
dre-mir-430a-3chr4: 28696691-28696772 [+]
dre-mir-430c-5chr4: 28696854-28696926 [+]
dre-mir-430b-6chr4: 28697111-28697191 [+]
dre-mir-430a-13chr4: 28697317-28697398 [+]
dre-mir-430c-6chr4: 28697458-28697530 [+]
dre-mir-430b-11chr4: 28697715-28697795 [+]
dre-mir-430a-16chr4: 28697921-28698002 [+]
dre-mir-430b-9chr4: 28698305-28698385 [+]
dre-mir-430a-5chr4: 28699035-28699116 [+]
dre-mir-430c-7chr4: 28699198-28699270 [+]
dre-mir-430b-12chr4: 28699455-28699535 [+]
dre-mir-430i-1chr4: 28699661-28699742 [+]
dre-mir-430c-8chr4: 28699824-28699896 [+]
dre-mir-430b-2chr4: 28700067-28700147 [+]
dre-mir-430a-6chr4: 28700798-28700879 [+]
dre-mir-430c-9chr4: 28700961-28701033 [+]
dre-mir-430b-7chr4: 28701218-28701298 [+]
dre-mir-430a-11chr4: 28701424-28701505 [+]
dre-mir-430c-10chr4: 28701587-28701659 [+]
dre-mir-430b-13chr4: 28701844-28701924 [+]
dre-mir-430i-2chr4: 28702050-28702131 [+]
dre-mir-430c-11chr4: 28702213-28702285 [+]
dre-mir-430b-18chr4: 28702456-28702536 [+]
dre-mir-430a-7chr4: 28703187-28703268 [+]
dre-mir-430c-12chr4: 28703350-28703422 [+]
dre-mir-430b-14chr4: 28703607-28703687 [+]
dre-mir-430a-17chr4: 28703813-28703894 [+]
dre-mir-430b-20chr4: 28704197-28704277 [+]
dre-mir-430a-8chr4: 28704927-28705008 [+]
dre-mir-430c-13chr4: 28705090-28705162 [+]
dre-mir-430b-15chr4: 28705347-28705427 [+]
dre-mir-430i-3chr4: 28705553-28705634 [+]
dre-mir-430c-14chr4: 28705716-28705788 [+]
dre-mir-430b-19chr4: 28705959-28706039 [+]
dre-mir-430a-9chr4: 28706690-28706771 [+]
dre-mir-430c-15chr4: 28706853-28706925 [+]
dre-mir-430b-16chr4: 28707110-28707190 [+]
dre-mir-430a-14chr4: 28707316-28707397 [+]
dre-mir-430c-16chr4: 28707457-28707529 [+]
dre-mir-430b-3chr4: 28707700-28707780 [+]
dre-mir-430a-10chr4: 28708430-28708511 [+]
dre-mir-430c-17chr4: 28708593-28708665 [+]
dre-mir-430b-8chr4: 28708850-28708930 [+]
dre-mir-430a-15chr4: 28709056-28709137 [+]
dre-mir-430c-18chr4: 28709197-28709269 [+]
dre-mir-430b-17chr4: 28709454-28709534 [+]
Database links

Mature sequence dre-miR-430b-5p

Accession MIMAT0031928
Sequence

11 - 

caacucuaacuuuagcaucuuuc

 - 33

Get sequence
Evidence not experimental

Mature sequence dre-miR-430b-3p

Accession MIMAT0001424
Previous IDsdre-miR-430b
Sequence

49 - 

aaagugcuaucaaguugggguag

 - 71

Get sequence
Evidence experimental; cloned [1-2]
Database links
Predicted targets

References

1
PMID:15774722 "MicroRNAs regulate brain morphogenesis in zebrafish" Giraldez AJ, Cinalli RM, Glasner ME, Enright AJ, Thomson JM, Baskerville S, Hammond SM, Bartel DP, Schier AF Science. 308:833-838(2005).
2
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).