Stem-loop sequence dre-mir-456

AccessionMI0002176
DescriptionDanio rerio miR-456 stem-loop
Gene family MIPF0000341; mir-456
Stem-loop
        u      u    g     uu       acau ug   cc 
5' gcugg ugugug gcag caucu  ccagucu    g  gau  a
   ||||| |||||| |||| |||||  |||||||    |  |||   
3' cgacc augcac uguu guaga  ggucgga    c  cug  g
        c      -    g     uu       ---- gu   ag 
Get sequence
Deep sequencing
1098 reads, 179 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
17: 22657078-22657162 [+]
sense
OTTDART00000025222 ; ttc27-001; intron 9
ENSDART00000151999 ; ttc27-001; intron 9
Database links

Mature sequence dre-miR-456

Accession MIMAT0001882
Sequence

54 - 

caggcugguuagaugguuguca

 - 75

Get sequence
Deep sequencing739 reads, 4 experiments
Evidence experimental; cloned [1]

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).