Stem-loop sequence dre-mir-456

AccessionMI0002176 (change log)
DescriptionDanio rerio miR-456 stem-loop
Gene family MIPF0000341; mir-456
Stem-loop
        u      u    g     uu       acau ug   cc 
5' gcugg ugugug gcag caucu  ccagucu    g  gau  a
   ||||| |||||| |||| |||||  |||||||    |  |||   
3' cgacc augcac uguu guaga  ggucgga    c  cug  g
        c      -    g     uu       ---- gu   ag 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr17: 22827063-22827147 [+]
sense
OTTDART00000025222 ; ttc27-001; intron 9
ENSDART00000151999 ; ttc27-001; intron 9
KZ115524.1: 208585-208669 [+]
sense
OTTDART00000025222 ; ttc27-001; intron 9
ENSDART00000151999 ; ttc27-001; intron 9
Database links

Mature sequence dre-miR-456

Accession MIMAT0001882
Sequence

54 - 

caggcugguuagaugguuguca

 - 75

Get sequence
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).