Stem-loop sequence dre-mir-457a

AccessionMI0002177
DescriptionDanio rerio miR-457a stem-loop
Gene family MIPF0000006; mir-15
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-15_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-15 microRNA precursor family is made up of small non-coding RNA genes that regulate gene expression. The family includes the related mir-15a and mir-15b sequences, as well as miR-16-1, miR-16-2, miR-195 and miR-497. These six highly conserved miRNAs are clustered on three separate chromosomes. In humans miR-15a and miR-16 are clustered within 0.5 kilobases at chromosome position 13q14. This region has been found to be the most commonly affected in chronic lymphocytic leukaemia (CLL), with deletions of the entire region in more than half of cases. Both miR-15a and miR-16 are thus frequently deleted or down-regulated in CLL samples with 13q14 deletions; occurring in more than two thirds of CLL cases. miR-15a/16-1 deletion has been shown to accelerate the proliferation of both human and mouse B-cells through modulation of the expression of genes controlling cell cycle progression. Studies have found the miR-15a/16-1 microRNA cluster to function as a tumour suppressor, with the oncogene BCL2 as its target. Specifically, miR-15a/16-1 downregulates BCL2 expression and is itself deleted or downregulated in tumour cells. There is a marked increase in BCL2 levels observed in advanced prostate tumour cases, which is inversely correlated with miR-15a/16-1 expression (and so corresponds to a decrease in miR-15a/16-1 levels). Inhibition of cell proliferation by the miR-15a/16-1 cluster occurs in both lymphoid and non-lymphoid tissue. The miR-15a/16-1 cluster has further been found to be highly expressed in CD5+ cells, therefore hinting at an important role of miR-15/16 in normal CD5+ B-cell homeostasis.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   ugc     a a         -uca         gcu    uc 
5'    cugac g agcagcaca    auauuggca   gccc  u
      ||||| | |||||||||    |||||||||   ||||  c
3'    gacug c ucgucgugu    uaugaccgu   uggg  u
   aca     c c         uugg         ---    uc 
Get sequence
Deep sequencing
7511 reads, 2.32e+03 reads per million, 4 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
7: 27197294-27197376 [+]
intergenic
Clustered miRNAs
< 10kb from dre-mir-457a
dre-mir-15b7: 27196742-27196875 [+]
dre-mir-457a7: 27197294-27197376 [+]
Database links

Mature sequence dre-miR-457a

Accession MIMAT0001883
Sequence

11 - 

aagcagcacaucaauauuggca

 - 32

Get sequence
Deep sequencing6565 reads, 4 experiments
Evidence experimental; cloned [1]

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).