Stem-loop sequence dre-mir-458

AccessionMI0002179 (change log)
DescriptionDanio rerio miR-458 stem-loop
Gene family MIPF0000179; mir-458
Stem-loop
        g  a    cg       c        --a   au 
5' gugca au gcag  ccauuua agagcuau   agc  c
   ||||| || ||||  ||||||| ||||||||   |||   
3' cacgu ua cguc  gguaagu ucucgaua   uug  a
        a  c    au       u        cug   au 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr14: 25159129-25159206 [-]
intergenic
Database links

Mature sequence dre-miR-458-5p

Accession MIMAT0032005
Sequence

12 - 

agcgccauuuacagagcuauaa

 - 33

Get sequence
Evidence not experimental
Database links

Mature sequence dre-miR-458-3p

Accession MIMAT0001885
Previous IDsdre-miR-458
Sequence

48 - 

auagcucuuugaaugguacugc

 - 69

Get sequence
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).