Stem-loop sequence dre-mir-458

AccessionMI0002179
DescriptionDanio rerio miR-458 stem-loop
Gene family MIPF0000179; mir-458
Stem-loop
        g  a    cg       c        --a   au 
5' gugca au gcag  ccauuua agagcuau   agc  c
   ||||| || ||||  ||||||| ||||||||   |||   
3' cacgu ua cguc  gguaagu ucucgaua   uug  a
        a  c    au       u        cug   au 
Get sequence
Deep sequencing
193 reads, 67.2 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
14: 26237185-26237262 [-]
intergenic
Database links

Mature sequence dre-miR-458-5p

Accession MIMAT0032005
Sequence

12 - 

agcgccauuuacagagcuauaa

 - 33

Get sequence
Deep sequencing69 reads, 4 experiments
Evidence not experimental

Mature sequence dre-miR-458-3p

Accession MIMAT0001885
Previous IDsdre-miR-458
Sequence

48 - 

auagcucuuugaaugguacugc

 - 69

Get sequence
Deep sequencing97 reads, 3 experiments
Evidence experimental; cloned [1]

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).