Stem-loop sequence dre-mir-460

AccessionMI0002181
Previous IDsdre-mir-460-1
DescriptionDanio rerio miR-460 stem-loop
Gene family MIPF0000134; mir-460
Stem-loop
       u    -   u        ca a       gaaaa 
5' cucc cggc ucc gcauugua  c cugugcg     c
   |||| |||| ||| ||||||||  | |||||||     a
3' gagg gucg agg uguaacau  g gacacgu     u
       u    u   -        ac c       acagg 
Get sequence
Deep sequencing
64 reads, 23.4 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
2: 2103466-2103542 [-]
sense
OTTDART00000023732 ; pth1ra-001; intron 6
ENSDART00000147808 ; pth1ra-001; intron 6
ENSDART00000101033 ; pth1ra-201; intron 7
Database links

Mature sequence dre-miR-460-5p

Accession MIMAT0001887
Sequence

11 - 

ccugcauuguacacacugugcg

 - 32

Get sequence
Deep sequencing24 reads, 3 experiments
Evidence experimental; cloned [1]

Mature sequence dre-miR-460-3p

Accession MIMAT0001888
Sequence

48 - 

cacagcgcauacaauguggaug

 - 69

Get sequence
Deep sequencing22 reads, 4 experiments
Evidence experimental; cloned [1]

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).