Stem-loop sequence dre-mir-460

AccessionMI0002181 (change log)
Previous IDsdre-mir-460-1
DescriptionDanio rerio miR-460 stem-loop
Gene family MIPF0000134; mir-460
Stem-loop
       u    -   u        ca a       gaaaa 
5' cucc cggc ucc gcauugua  c cugugcg     c
   |||| |||| ||| ||||||||  | |||||||     a
3' gagg gucg agg uguaacau  g gacacgu     u
       u    u   -        ac c       acagg 
Get sequence
Deep sequencing
2394 reads, 109 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr2: 2301358-2301434 [-]
sense
OTTDART00000023732 ; pth1ra-001; intron 6
ENSDART00000147808 ; pth1ra-001; intron 6
ENSDART00000101033 ; pth1ra-201; intron 7
Database links

Mature sequence dre-miR-460-5p

Accession MIMAT0001887
Sequence

11 - 

ccugcauuguacacacugugcg

 - 32

Get sequence
Deep sequencing553 reads, 9 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

Mature sequence dre-miR-460-3p

Accession MIMAT0001888
Sequence

48 - 

cacagcgcauacaauguggaug

 - 69

Get sequence
Deep sequencing1841 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).