![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-466a |
||||||||||||||||||||||||||||||||||||||||||||||||||||||
Accession | MI0002401 (change log) | |||||||||||||||||||||||||||||||||||||||||||||||||||||
Previous IDs | mmu-mir-466 | |||||||||||||||||||||||||||||||||||||||||||||||||||||
Description | Mus musculus miR-466a stem-loop | |||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene family | MIPF0000208; mir-466 | |||||||||||||||||||||||||||||||||||||||||||||||||||||
Literature search |
![]()
28 open access papers mention mmu-mir-466a | |||||||||||||||||||||||||||||||||||||||||||||||||||||
Stem-loop |
--ua uua c -- - g 5' uaugugu ugugugugua aug ua cauau u ||||||| |||||||||| ||| || ||||| 3' auacaca gcacauacau uac au guaua g caga --c a cu a a |
|||||||||||||||||||||||||||||||||||||||||||||||||||||
Deep sequencing |
| |||||||||||||||||||||||||||||||||||||||||||||||||||||
Confidence |
Annotation confidence: not enough data
| |||||||||||||||||||||||||||||||||||||||||||||||||||||
Comments |
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The ends of the miRNA may be offset with respect to previous annotations. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||
Genome context |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||
Clustered miRNAs |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||
Database links |
|
Mature sequence mmu-miR-466a-5p |
|
Accession | MIMAT0004759 |
Sequence |
11 - uauguguguguacauguacaua - 32 |
Deep sequencing | 4221 reads, 83 experiments |
Evidence | experimental; cloned [2], Illumina [3-4] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-466a-3p |
|
Accession | MIMAT0002107 |
Previous IDs | mmu-miR-466 |
Sequence |
50 - uauacauacacgcacacauaaga - 72 |
Deep sequencing | 23174 reads, 102 experiments |
Evidence | experimental; cloned [1-2], Illumina [3-4] |
Database links |
|
Predicted targets |
|
References |
|
1 | |
2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
3 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
4 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|