![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-470 |
||||||||
Accession | MI0002405 (change log) | |||||||
Symbol | MGI:Mir470 | |||||||
Description | Mus musculus miR-470 stem-loop | |||||||
Gene family | MIPF0000386; mir-743 | |||||||
Literature search |
![]()
11 open access papers mention mmu-mir-470 | |||||||
Stem-loop |
----cag ug cu c -ga aa 5' ugcucuucu ga gg acuggu guu a ||||||||| || || |||||| ||| 3' augagaaga cu cc ugacca uaa c acucgaa gu uu a aca au |
|||||||
Deep sequencing |
| |||||||
Confidence |
Annotation confidence: high
| |||||||
Comments |
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. |
|||||||
Genome context |
|
|||||||
Clustered miRNAs |
|
|||||||
Database links |
|
Mature sequence mmu-miR-470-5p |
|
Accession | MIMAT0002111 |
Previous IDs | mmu-miR-470 |
Sequence |
9 - uucuuggacuggcacuggugagu - 31 |
Deep sequencing | 235203 reads, 52 experiments |
Evidence | experimental; cloned [1-3], Illumina [4-5] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-470-3p |
|
Accession | MIMAT0004760 |
Previous IDs | mmu-miR-470* |
Sequence |
44 - aaccaguaccuuucugagaaga - 65 |
Deep sequencing | 1377 reads, 24 experiments |
Evidence | experimental; cloned [3], Illumina [4-5] |
Database links |
|
Predicted targets |
|
References |
|
1 | |
2 | |
3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
4 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
5 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|