Stem-loop sequence ssc-mir-301

AccessionMI0002432 (change log)
DescriptionSus scrofa miR-301 stem-loop
Gene family MIPF0000034; mir-130
Literature search

3 open access papers mention ssc-mir-301
(5 sentences)

Stem-loop
   --   aa  a     c    ---u      c   ----a       
5'   gcu  ca augcu ugac    uuauug acu     cuguac 
     |||  || ||||| ||||    |||||| |||     ||||| u
3'   cga  gu uacga acug    gauaac uga     gacauu 
   ga   ga  c     a    uuau      c   ccauc       
Get sequence
Deep sequencing
26 reads, 0 reads per million, 10 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssc-miR-301

Accession MIMAT0002138
Sequence

48 - 

caguccaauaguauugucaaagc

 - 70

Get sequence
Deep sequencing12 reads, 7 experiments
Evidence by similarity; MI0000745

References

1
PMID:15885146 "Pigs in sequence space: a 0.66X coverage pig genome survey based on shotgun sequencing" Wernersson R, Schierup MH, Jorgensen FG, Gorodkin J, Panitz F, Staerfeldt HH, Christensen OF, Mailund T, Hornshoj H, Klein A, Wang J, Liu B, Hu S, Dong W, Li W, Wong GK, Yu J, Wang J, Bendixen C, Fredholm M, Brunak S, Yang H, Bolund L BMC Genomics. 6:70(2005).