![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence ssc-let-7f-1 |
||||||
Accession | MI0002446 (change log) | |||||
Previous IDs | ssc-let-7f | |||||
Description | Sus scrofa let-7f-1 stem-loop | |||||
Gene family | MIPF0000002; let-7 | |||||
Literature search |
![]()
47 open access papers mention ssc-let-7f-1 | |||||
Stem-loop |
u u gu uuagggucauac 5' guggga gag aguagauuguauaguu c |||||| ||| |||||||||||||||| 3' cacccu uuc ucaucugacauaucaa c g - ug uagagguucuac |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: not enough data
| |||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
Mature sequence ssc-let-7f-5p |
|
Accession | MIMAT0002152 |
Sequence |
8 - ugagguaguagauuguauaguu - 29 |
Deep sequencing | 153350 reads, 15 experiments |
Evidence | experimental; Illumina [1-2] |
References |
|
1 |
PMID:15885146
"Pigs in sequence space: a 0.66X coverage pig genome survey based on shotgun sequencing"
BMC Genomics. 6:70(2005).
|
2 |
PMID:20180025
"Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue"
Mol Biol Rep. 37:3567-3574(2010).
|
3 |
PMID:21312241
"MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing"
J Cell Biochem. 112:1318-1328(2011).
|
4 |
PMID:24499489
"Exploration of microRNAs in porcine milk exosomes"
BMC Genomics. 15:100(2014).
|