Stem-loop sequence ssc-let-7i

AccessionMI0002447 (change log)
DescriptionSus scrofa let-7i stem-loop
Gene family MIPF0000002; let-7
Literature search

42 open access papers mention ssc-let-7i
(120 sentences)

Stem-loop
        u                 u   --------  u     ugu 
5' cuggc gagguaguaguuugugc guu        gg cgggu   g
   ||||| ||||||||||||||||| |||        || |||||   a
3' gaucg uuccgucaucgaacgcg caa        uc gcccg   c
        -                 u   uagaggug  -     uua 
Get sequence
Deep sequencing
57064 reads, 1.23e+04 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr5: 30021224-30021308 [+]
intergenic
Database links

Mature sequence ssc-let-7i-5p

Accession MIMAT0002153
Sequence

6 - 

ugagguaguaguuugugcu

 - 24

Get sequence
Deep sequencing56992 reads, 15 experiments
Evidence experimental; cloned [2], Illumina [3-4]

Mature sequence ssc-let-7i-3p

Accession MIMAT0037319
Sequence

62 - 

cugcgcaagcuacugccuugcu

 - 83

Get sequence
Deep sequencing71 reads, 9 experiments
Evidence experimental; Illumina [5]

References

1
PMID:15885146 "Pigs in sequence space: a 0.66X coverage pig genome survey based on shotgun sequencing" Wernersson R, Schierup MH, Jorgensen FG, Gorodkin J, Panitz F, Staerfeldt HH, Christensen OF, Mailund T, Hornshoj H, Klein A, Wang J, Liu B, Hu S, Dong W, Li W, Wong GK, Yu J, Wang J, Bendixen C, Fredholm M, Brunak S, Yang H, Bolund L BMC Genomics. 6:70(2005).
2
PMID:20180025 "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue" Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS Mol Biol Rep. 37:3567-3574(2010).
3
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
4
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).
5
PMID:25230983 "The characteristics of the porcine (Sus scrofa) liver miRNAome with the use of next generation sequencing" Pawlina K, Gurgul A, Oczkowicz M, Bugno-Poniewierska M J Appl Genet. 56:239-252(2015).