![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence ssc-let-7i |
|||||
Accession | MI0002447 (change log) | ||||
Description | Sus scrofa let-7i stem-loop | ||||
Gene family | MIPF0000002; let-7 | ||||
Literature search |
![]()
42 open access papers mention ssc-let-7i | ||||
Stem-loop |
u u -------- u ugu 5' cuggc gagguaguaguuugugc guu gg cgggu g ||||| ||||||||||||||||| ||| || ||||| a 3' gaucg uuccgucaucgaacgcg caa uc gcccg c - u uagaggug - uua |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
Mature sequence ssc-let-7i-5p |
|
Accession | MIMAT0002153 |
Sequence |
6 - ugagguaguaguuugugcu - 24 |
Deep sequencing | 56992 reads, 15 experiments |
Evidence | experimental; cloned [2], Illumina [3-4] |
Mature sequence ssc-let-7i-3p |
|
Accession | MIMAT0037319 |
Sequence |
62 - cugcgcaagcuacugccuugcu - 83 |
Deep sequencing | 71 reads, 9 experiments |
Evidence | experimental; Illumina [5] |
References |
|
1 |
PMID:15885146
"Pigs in sequence space: a 0.66X coverage pig genome survey based on shotgun sequencing"
BMC Genomics. 6:70(2005).
|
2 |
PMID:20180025
"Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue"
Mol Biol Rep. 37:3567-3574(2010).
|
3 |
PMID:21312241
"MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing"
J Cell Biochem. 112:1318-1328(2011).
|
4 |
PMID:24499489
"Exploration of microRNAs in porcine milk exosomes"
BMC Genomics. 15:100(2014).
|
5 |
PMID:25230983
"The characteristics of the porcine (Sus scrofa) liver miRNAome with the use of next generation sequencing"
J Appl Genet. 56:239-252(2015).
|