Stem-loop sequence ssc-mir-153

AccessionMI0002454 (change log)
DescriptionSus scrofa miR-153 stem-loop
Gene family MIPF0000050; mir-153
Literature search

1 open access papers mention ssc-mir-153
(1 sentences)

Stem-loop
   a     gg      -             gu       -a  aa 
5'  gcggu  ccagug ucauuuuugugau  ugcagcu  gu  u
    |||||  |||||| |||||||||||||  |||||||  ||  a
3'  uguca  gguuac agugaaaacacug  acguuga  cg  u
   g     aa      u             au       cc  ag 
Get sequence
Deep sequencing
60 reads, 0 reads per million, 10 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssc-miR-153

Accession MIMAT0002160
Sequence

53 - 

uugcauagucacaaaaguga

 - 72

Get sequence
Deep sequencing58 reads, 10 experiments
Evidence by similarity; MI0000464

References

1
PMID:15885146 "Pigs in sequence space: a 0.66X coverage pig genome survey based on shotgun sequencing" Wernersson R, Schierup MH, Jorgensen FG, Gorodkin J, Panitz F, Staerfeldt HH, Christensen OF, Mailund T, Hornshoj H, Klein A, Wang J, Liu B, Hu S, Dong W, Li W, Wong GK, Yu J, Wang J, Bendixen C, Fredholm M, Brunak S, Yang H, Bolund L BMC Genomics. 6:70(2005).