![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-484 |
|||||
Accession | MI0002468 (change log) | ||||
Symbol | HGNC:MIR484 | ||||
Description | Homo sapiens miR-484 stem-loop | ||||
Gene family | MIPF0000219; mir-484 | ||||
Literature search |
![]()
40 open access papers mention hsa-mir-484 | ||||
Stem-loop |
a ----uc cuca c au -c a 5' gcc gucagg guc ccucccg aaa cccu a ||| |||||| ||| ||||||| ||| |||| 3' cgg cggucc cag ggggggc uuu ggga a g uuuuuu ---- u cc ca u |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence hsa-miR-484 |
|
Accession | MIMAT0002174 |
Sequence |
8 - ucaggcucaguccccucccgau - 29 |
Deep sequencing | 93520 reads, 158 experiments |
Evidence | experimental; cloned [1-3], Northern [1] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:15978578
"Identification of human fetal liver miRNAs by a novel method"
FEBS Lett. 579:3849-3854(2005).
|
2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
3 |
PMID:17616659
"Patterns of known and novel small RNAs in human cervical cancer"
Cancer Res. 67:6031-6043(2007).
|