|
miRBase |
|
Mature sequence hsa-miR-485-5p |
|
| Accession | MIMAT0002175 |
| Sequence |
9 - agaggcuggccgugaugaauuc - 30 |
| Deep sequencing | 702 reads, 11 experiments |
| Evidence | experimental; array-cloned [2], cloned [3] |
| Validated targets |
|
| Predicted targets |
|
Mature sequence hsa-miR-485-3p |
|
| Accession | MIMAT0002176 |
| Sequence |
46 - gucauacacggcucuccucucu - 67 |
| Deep sequencing | 641 reads, 3 experiments |
| Evidence | experimental; cloned [1,3], array-cloned [2] |
| Validated targets |
|
| Predicted targets |
|
References |
|
| 1 |
PMID:15978578
"Identification of human fetal liver miRNAs by a novel method"
FEBS Lett. 579:3849-3854(2005).
|
| 2 |
PMID:15965474
"Identification of hundreds of conserved and nonconserved human microRNAs"
Nat Genet. 37:766-770(2005).
|
| 3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|