![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-487a |
||||||||||||||||||||||||||||||||||||
Accession | MI0002471 (change log) | |||||||||||||||||||||||||||||||||||
Previous IDs | hsa-mir-487 | |||||||||||||||||||||||||||||||||||
Symbol | HGNC:MIR487A | |||||||||||||||||||||||||||||||||||
Description | Homo sapiens miR-487a stem-loop | |||||||||||||||||||||||||||||||||||
Gene family | MIPF0000018; mir-154 | |||||||||||||||||||||||||||||||||||
Literature search |
![]()
14 open access papers mention hsa-mir-487a | |||||||||||||||||||||||||||||||||||
Stem-loop |
u g uua c - c a 5' gguacu gaaga ugg ucccug ugug uucg uua u |||||| ||||| ||| |||||| |||| |||| ||| u 3' cuauga uuuuu acc agggac auac aagc agu u c g uac - u - a |
|||||||||||||||||||||||||||||||||||
Deep sequencing |
| |||||||||||||||||||||||||||||||||||
Confidence |
Annotation confidence: high
| |||||||||||||||||||||||||||||||||||
Genome context |
|
|||||||||||||||||||||||||||||||||||
Clustered miRNAs |
|
|||||||||||||||||||||||||||||||||||
Database links |
|
Mature sequence hsa-miR-487a-5p |
|
Accession | MIMAT0026559 |
Sequence |
13 - gugguuaucccugcuguguucg - 34 |
Deep sequencing | 1217 reads, 75 experiments |
Evidence | experimental; Illumina [4] |
Predicted targets |
|
Mature sequence hsa-miR-487a-3p |
|
Accession | MIMAT0002178 |
Previous IDs | hsa-miR-487 |
Sequence |
49 - aaucauacagggacauccaguu - 70 |
Deep sequencing | 1924 reads, 100 experiments |
Evidence | experimental; cloned [1-3], Northern [1], Illumina [4] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:15978578
"Identification of human fetal liver miRNAs by a novel method"
FEBS Lett. 579:3849-3854(2005).
|
2 |
PMID:16274478
"Identification of clustered microRNAs using an ab initio prediction method"
BMC Bioinformatics. 6:267(2005).
|
3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
4 |
PMID:23034410
"Birth and expression evolution of mammalian microRNA genes"
Genome Res. 23:34-45(2013).
|