Stem-loop sequence kshv-miR-K12-2

AccessionMI0002476
DescriptionKaposi sarcoma-associated herpesvirus miR-K12-2 stem-loop
Stem-loop
     -   u   u  c  a  g      g  uc      agccauu    c 
5' gg guc acu cg ua cu uagucc gg  gaucug       gaag a
   || ||| ||| || || || |||||| ||  ||||||       ||||  
3' cc cag ugg gc gu ga aucggg cc  cuagac       cuuc a
     a   -   c  c  c  g      a  uu      -------    g 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Comments

Cai et al. define the likely miRNA primary transcripts in [2].

Genome context
Coordinates (EMBL:U75698.1) Overlapping transcripts
KSU75698: 121674-121764 [-]
intergenic
Clustered miRNAs
< 10kb from kshv-miR-K12-2
kshv-mir-K12-1KSU75698: 121847-121913 [-]
kshv-miR-K12-2KSU75698: 121674-121764 [-]
kshv-mir-K12-3KSU75698: 121544-121613 [-]
kshv-mir-K12-4KSU75698: 121413-121482 [-]
kshv-mir-K12-5KSU75698: 121263-121332 [-]
kshv-mir-K12-6KSU75698: 120761-120822 [-]
kshv-mir-K12-11KSU75698: 120576-120646 [-]
kshv-mir-K12-7KSU75698: 120355-120426 [-]
kshv-mir-K12-8KSU75698: 119943-120012 [-]
kshv-mir-K12-9KSU75698: 119300-119365 [-]
kshv-mir-K12-10aKSU75698: 117967-118036 [-]
kshv-mir-K12-12KSU75698: 117674-117771 [-]

Mature sequence kshv-miR-K12-2-5p

Accession MIMAT0002183
Previous IDskshv-miR-K12-2
Sequence

15 - 

aacuguaguccgggucgaucug

 - 36

Get sequence
Evidence experimental; cloned [1], Illumina [3], SOLiD [4]

Mature sequence kshv-miR-K12-2-3p

Accession MIMAT0015215
Previous IDskshv-miR-K12-2*
Sequence

58 - 

gaucuuccagggcuagagcug

 - 78

Get sequence
Evidence experimental; Illumina [3], SOLiD [4]

References

1
PMID:15800047 "Kaposi's sarcoma-associated herpesvirus expresses an array of viral microRNAs in latently infected cells" Cai X, Lu S, Zhang Z, Gonzalez CM, Damania B, Cullen BR Proc Natl Acad Sci U S A. 102:5570-5575(2005).
2
3
4
PMID:20566670 "Small RNA profiling reveals antisense transcription throughout the KSHV genome and novel small RNAs" Lin YT, Kincaid RP, Arasappan D, Dowd SE, Hunicke-Smith SP, Sullivan CS RNA. 16:1540-1558(2010).