miRBase entry: mml-mir-30b

Stem-loop mml-mir-30b


Accession
MI0002502
Description
Macaca mulatta mml-mir-30b precursor miRNA

Literature search
3 open access papers mention mml-mir-30b
(19 sentences)

Sequence

28452 reads, 213 reads per million, 8 experiments
accaaguuucaguucaUGUAAACAUCCUACACUCAGCuguaauacauggauuggCUGGGAGGUGGAUGUUUACUUCagcugacuugga
.(((((..((((((...((((((((((.((.((((((((............))))))))..))))))))))))...))))))))))).

Structure
a     uu      caU          U  -A        uaaua 
 ccaag  ucaguu   GUAAACAUCC AC  CUCAGCug     c
 |||||  ||||||   |||||||||| ||  ||||||||      
 gguuc  agucga   CAUUUGUAGG UG  GGGUCggu     a
a     --      CUU          -  GA        uaggu 


Annotation confidence Medium
Do you think this miRNA is real?
Comments
Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [2]. The expression of this mature miRNA was validated by Miska et al [1].

Genome context
chr8: 134094376-134094463 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from mml-mir-30b
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mml-miR-30b-5p

Accession MIMAT0002213
Description Macaca mulatta mml-miR-30b-5p mature miRNA
Sequence 17 - UGUAAACAUCCUACACUCAGC - 37
Evidence experimental
cloned [1], Illumina [3]
Database links
Predicted targets

Mature mml-miR-30b-3p

Accession MIMAT0026563
Description Macaca mulatta mml-miR-30b-3p mature miRNA
Sequence 55 - CUGGGAGGUGGAUGUUUACUUC - 76
Evidence experimental
Illumina [3]

References

  1. PubMed ID: 15345052
    Microarray analysis of microRNA expression in the developing mammalian brain
    Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR
    Genome Biol (2004) 5:R68

  2. PubMed ID: 15652478
    Phylogenetic shadowing and computational identification of human microRNA genes
    "Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E"
    "Cell (2005) 120:21-24

  3. PubMed ID: 23034410
    Birth and expression evolution of mammalian microRNA genes
    "Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H"
    "Genome Res (2013) 23:34-45